EMAIL THIS PAGE TO A FRIEND

ZNF600

zinc finger protein 600

8 Gene Product Result for
Synonyms: KR-ZNF1
Species: Human ZNF600(162966)
UniProtKB ID: Q6ZNG1, Q6MZR0
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198457 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198457 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198457 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU114401 MISSION® esiRNA esiRNA human ZNF600 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_198457 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198457 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00044751 predicted 997
2 SASI_Hs01_00044752 predicted 1221
3 SASI_Hs02_00371975 predicted 1808
4 SASI_Hs01_00044753 predicted 2506
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198457
ZNF600 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 600
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000018107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198457.1-500s1c1
Sequence:CCGGGCTGGAAACAAGCCTATTAAACTCGAGTTTAATAGGCTTGTTTCCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198457.1-636s1c1
Sequence:CCGGCATCCCAAAGAATTTCTCCTACTCGAGTAGGAGAAATTCTTTGGGATGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198457.1-1662s1c1
Sequence:CCGGCCGGAGAGAAACCATACAAATCTCGAGATTTGTATGGTTTCTCTCCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018103    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198457.1-1468s1c1
Sequence:CCGGCCTGGTAAGACATACTAGAATCTCGAGATTCTAGTATGTCTTACCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198457.1-2249s1c1
Sequence:CCGGCCTGGAAAGAAACCATACAAACTCGAGTTTGTATGGTTTCTTTCCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436031    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198457.2-1228s21c1
Sequence:CCGGATCAACCCTTGAGTCACATAACTCGAGTTATGTGACTCAAGGGTTGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433089    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198457.2-2155s21c1
Sequence:CCGGACAACTTTCACTTCATCATAGCTCGAGCTATGATGAAGTGAAAGTTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417191    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198457.2-1802s21c1
Sequence:CCGGACCTTCCGTCTGAGGTCATACCTCGAGGTATGACCTCAGACGGAAGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424087    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198457.2-1313s21c1
Sequence:CCGGTCTCAGCTGGCAAGACATAAACTCGAGTTTATGTCTTGCCAGCTGAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426370    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198457.2-997s21c1
Sequence:CCGGTAGACTTCACACTGCAGTAAACTCGAGTTTACTGCAGTGTGAAGTCTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198457
ZNF600 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 600
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000018107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198457.1-500s1c1
Sequence:CCGGGCTGGAAACAAGCCTATTAAACTCGAGTTTAATAGGCTTGTTTCCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198457.1-636s1c1
Sequence:CCGGCATCCCAAAGAATTTCTCCTACTCGAGTAGGAGAAATTCTTTGGGATGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198457.1-1662s1c1
Sequence:CCGGCCGGAGAGAAACCATACAAATCTCGAGATTTGTATGGTTTCTCTCCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018103    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198457.1-1468s1c1
Sequence:CCGGCCTGGTAAGACATACTAGAATCTCGAGATTCTAGTATGTCTTACCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198457.1-2249s1c1
Sequence:CCGGCCTGGAAAGAAACCATACAAACTCGAGTTTGTATGGTTTCTTTCCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436031    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198457.2-1228s21c1
Sequence:CCGGATCAACCCTTGAGTCACATAACTCGAGTTATGTGACTCAAGGGTTGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433089    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198457.2-2155s21c1
Sequence:CCGGACAACTTTCACTTCATCATAGCTCGAGCTATGATGAAGTGAAAGTTGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417191    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198457.2-1802s21c1
Sequence:CCGGACCTTCCGTCTGAGGTCATACCTCGAGGTATGACCTCAGACGGAAGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424087    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198457.2-1313s21c1
Sequence:CCGGTCTCAGCTGGCAAGACATAAACTCGAGTTTATGTCTTGCCAGCTGAGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426370    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198457.2-997s21c1
Sequence:CCGGTAGACTTCACACTGCAGTAAACTCGAGTTTACTGCAGTGTGAAGTCTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198457
ZNF600 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 600
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000018107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198457.1-500s1c1
Sequence:CCGGGCTGGAAACAAGCCTATTAAACTCGAGTTTAATAGGCTTGTTTCCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198457.1-636s1c1
Sequence:CCGGCATCCCAAAGAATTTCTCCTACTCGAGTAGGAGAAATTCTTTGGGATGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198457.1-1662s1c1
Sequence:CCGGCCGGAGAGAAACCATACAAATCTCGAGATTTGTATGGTTTCTCTCCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018103    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198457.1-1468s1c1
Sequence:CCGGCCTGGTAAGACATACTAGAATCTCGAGATTCTAGTATGTCTTACCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198457.1-2249s1c1
Sequence:CCGGCCTGGAAAGAAACCATACAAACTCGAGTTTGTATGGTTTCTTTCCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436031    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198457.2-1228s21c1
Sequence:CCGGATCAACCCTTGAGTCACATAACTCGAGTTATGTGACTCAAGGGTTGATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433089    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198457.2-2155s21c1
Sequence:CCGGACAACTTTCACTTCATCATAGCTCGAGCTATGATGAAGTGAAAGTTGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417191    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198457.2-1802s21c1
Sequence:CCGGACCTTCCGTCTGAGGTCATACCTCGAGGTATGACCTCAGACGGAAGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424087    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198457.2-1313s21c1
Sequence:CCGGTCTCAGCTGGCAAGACATAAACTCGAGTTTATGTCTTGCCAGCTGAGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426370    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198457.2-997s21c1
Sequence:CCGGTAGACTTCACACTGCAGTAAACTCGAGTTTACTGCAGTGTGAAGTCTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)