EMAIL THIS PAGE TO A FRIEND

ZNF606

zinc finger protein 606

139 Gene Product Result for
Synonyms: ZNF328
UniProtKB ID: Q8WXB4, A8KAN2, Q8NE04, Q96JH5
Gene ID:
domestic guinea pig(100721196) zinc finger protein 606
naked mole-rat(101713223) zinc finger protein 606
cow(616329) zinc finger protein 606
sheep(101111481) zinc finger protein 606
dog(484238) zinc finger protein 606
domestic cat(101088199) zinc finger protein 606
Horse(100063489) zinc finger protein 606
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025027 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_025027 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_025027 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_025027 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025027 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00048320 predicted 1714
2 SASI_Hs01_00048321 predicted 2184
3 SASI_Hs02_00357685 predicted 1235
4 SASI_Hs01_00048323 predicted 1722
5 SASI_Hs02_00357686 predicted 3042
6 SASI_Hs01_00048324 predicted 2944
7 SASI_Hs01_00048325 predicted 1583
8 SASI_Hs01_00048326 predicted 2987
9 SASI_Hs01_00048328 predicted 1190
10 SASI_Hs01_00048329 predicted 1114
11 SASI_Hs01_00048322 predicted 1274
12 SASI_Hs01_00048327 predicted 1360
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025027
VALIDATED
ZNF606 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 606
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000234338    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025027.3-1594s21c1
Sequence:CCGGTTTAACCAGAGCCCATCATTTCTCGAGAAATGATGGGCTCTGGTTAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234339    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025027.3-2269s21c1
Sequence:CCGGGACTACTCAGCCCTTAGTAAACTCGAGTTTACTAAGGGCTGAGTAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218898    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025027.3-1430s21c1
Sequence:GTACCGGATCAGTCCATTCAACCTATTTCTCGAGAAATAGGTTGAATGGACTGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234341    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025027.3-3236s21c1
Sequence:CCGGCCCTTATGGTCTACCAGTAATCTCGAGATTACTGGTAGACCATAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234340    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_025027.3-2771s21c1
Sequence:CCGGATGAGAGTTCATCCCTTATTGCTCGAGCAATAAGGGATGAACTCTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016103    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_025027.2-3089s1c1
Sequence:CCGGGCTCACCTTGTTAGACATCAACTCGAGTTGATGTCTAACAAGGTGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025027.2-1946s1c1
Sequence:CCGGGCAGATAAGGTTACCTGTGAACTCGAGTTCACAGGTAACCTTATCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025027.2-1723s1c1
Sequence:CCGGCCAATTAGAAATGTACCACATCTCGAGATGTGGTACATTTCTAATTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025027.2-3345s1c1
Sequence:CCGGCCCTTATTGTACACCTAAGAACTCGAGTTCTTAGGTGTACAATAAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025027.2-1829s1c1
Sequence:CCGGGCAGAGTTTAGCCAGAACTTACTCGAGTAAGTTCTGGCTAAACTCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025027
VALIDATED
ZNF606 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 606
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000234338    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025027.3-1594s21c1
Sequence:CCGGTTTAACCAGAGCCCATCATTTCTCGAGAAATGATGGGCTCTGGTTAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234339    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025027.3-2269s21c1
Sequence:CCGGGACTACTCAGCCCTTAGTAAACTCGAGTTTACTAAGGGCTGAGTAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218898    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025027.3-1430s21c1
Sequence:GTACCGGATCAGTCCATTCAACCTATTTCTCGAGAAATAGGTTGAATGGACTGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234341    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025027.3-3236s21c1
Sequence:CCGGCCCTTATGGTCTACCAGTAATCTCGAGATTACTGGTAGACCATAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234340    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_025027.3-2771s21c1
Sequence:CCGGATGAGAGTTCATCCCTTATTGCTCGAGCAATAAGGGATGAACTCTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016103    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_025027.2-3089s1c1
Sequence:CCGGGCTCACCTTGTTAGACATCAACTCGAGTTGATGTCTAACAAGGTGAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025027.2-1946s1c1
Sequence:CCGGGCAGATAAGGTTACCTGTGAACTCGAGTTCACAGGTAACCTTATCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025027.2-1723s1c1
Sequence:CCGGCCAATTAGAAATGTACCACATCTCGAGATGTGGTACATTTCTAATTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025027.2-3345s1c1
Sequence:CCGGCCCTTATTGTACACCTAAGAACTCGAGTTCTTAGGTGTACAATAAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025027.2-1829s1c1
Sequence:CCGGGCAGAGTTTAGCCAGAACTTACTCGAGTAAGTTCTGGCTAAACTCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025027
VALIDATED
ZNF606 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 606
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000234338    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025027.3-1594s21c1
Sequence:CCGGTTTAACCAGAGCCCATCATTTCTCGAGAAATGATGGGCTCTGGTTAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234339    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025027.3-2269s21c1
Sequence:CCGGGACTACTCAGCCCTTAGTAAACTCGAGTTTACTAAGGGCTGAGTAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218898    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025027.3-1430s21c1
Sequence:GTACCGGATCAGTCCATTCAACCTATTTCTCGAGAAATAGGTTGAATGGACTGATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234341    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025027.3-3236s21c1
Sequence:CCGGCCCTTATGGTCTACCAGTAATCTCGAGATTACTGGTAGACCATAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234340    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_025027.3-2771s21c1
Sequence:CCGGATGAGAGTTCATCCCTTATTGCTCGAGCAATAAGGGATGAACTCTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016103    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_025027.2-3089s1c1
Sequence:CCGGGCTCACCTTGTTAGACATCAACTCGAGTTGATGTCTAACAAGGTGAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025027.2-1946s1c1
Sequence:CCGGGCAGATAAGGTTACCTGTGAACTCGAGTTCACAGGTAACCTTATCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025027.2-1723s1c1
Sequence:CCGGCCAATTAGAAATGTACCACATCTCGAGATGTGGTACATTTCTAATTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025027.2-3345s1c1
Sequence:CCGGCCCTTATTGTACACCTAAGAACTCGAGTTCTTAGGTGTACAATAAGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025027.2-1829s1c1
Sequence:CCGGGCAGAGTTTAGCCAGAACTTACTCGAGTAAGTTCTGGCTAAACTCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)