EMAIL THIS PAGE TO A FRIEND

ZNF609

zinc finger protein 609

187 Gene Product Result for
UniProtKB ID: O15014, Q0D2I2
Gene ID:
Zebrafish(555219) zinc finger protein 609
chicken(415331) zinc finger protein 609
Horse(100053683) zinc finger protein 609
domestic cat(101086814) zinc finger protein 609
dog(478342) zinc finger protein 609
cow(510374) zinc finger protein 609
sheep(101108231) zinc finger protein 609
domestic guinea pig(100727747) zinc finger protein 609
naked mole-rat(101702794) zinc finger protein 609
Domestic Rabbit(100342732) zinc finger protein 609
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015042 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015042 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015042 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU033021 MISSION® esiRNA esiRNA human ZNF609 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015042 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015042 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00026781 predicted 3016
2 SASI_Hs01_00026783 predicted 3220
3 SASI_Hs01_00026784 predicted 1001
4 SASI_Hs01_00026785 predicted 2680
5 SASI_Hs01_00026786 predicted 973
6 SASI_Hs01_00026787 predicted 1386
7 SASI_Hs01_00026789 predicted 1511
8 SASI_Hs01_00026790 predicted 2683
9 SASI_Hs02_00346879 predicted 3498
10 SASI_Hs02_00346880 predicted 2648
11 SASI_Hs01_00026782 predicted 711
12 SASI_Hs01_00026788 predicted 717
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015042
VALIDATED
ZNF609 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 609
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015042.1-4135s1c1
Sequence:CCGGGCACAGTACAACTTACCCTATCTCGAGATAGGGTAAGTTGTACTGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015042.1-2653s1c1
Sequence:CCGGCAGAGCAAAGACTCACCATATCTCGAGATATGGTGAGTCTTTGCTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015042.1-3930s1c1
Sequence:CCGGGAGCAAGTCTCCCACGATAAGCTCGAGCTTATCGTGGGAGACTTGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183857    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015042.1-4844s1c1
Sequence:CCGGCCCATTTACATGAGCACATATCTCGAGATATGTGCTCATGTAAATGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015042.1-1380s1c1
Sequence:CCGGCAAGCGTGTCCGTACTAATTCCTCGAGGAATTAGTACGGACACGCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000131000    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_015042.1-2794s1c1
Sequence:CCGGCCTGAGAGCATAGAAGGGAAACTCGAGTTTCCCTTCTATGCTCTCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179391    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_015042.1-2599s1c1
Sequence:CCGGGCCGAACAGTTGGTTAAAGAACTCGAGTTCTTTAACCAACTGTTCGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000131108    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_015042.1-3009s1c1
Sequence:CCGGGCAGTACGAAGAACAGCAGAACTCGAGTTCTGCTGTTCTTCGTACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219872    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_015042.1-1601s1c1
Sequence:CCGGAGTACGGAGAGGAACCTATTCCTCGAGGAATAGGTTCCTCTCCGTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180097    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015042.1-5289s1c1
Sequence:CCGGCCTGTCATCTAGCCATCTGATCTCGAGATCAGATGGCTAGATGACAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015042
VALIDATED
ZNF609 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 609
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015042.1-4135s1c1
Sequence:CCGGGCACAGTACAACTTACCCTATCTCGAGATAGGGTAAGTTGTACTGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015042.1-2653s1c1
Sequence:CCGGCAGAGCAAAGACTCACCATATCTCGAGATATGGTGAGTCTTTGCTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015042.1-3930s1c1
Sequence:CCGGGAGCAAGTCTCCCACGATAAGCTCGAGCTTATCGTGGGAGACTTGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183857    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015042.1-4844s1c1
Sequence:CCGGCCCATTTACATGAGCACATATCTCGAGATATGTGCTCATGTAAATGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015042.1-1380s1c1
Sequence:CCGGCAAGCGTGTCCGTACTAATTCCTCGAGGAATTAGTACGGACACGCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000131000    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_015042.1-2794s1c1
Sequence:CCGGCCTGAGAGCATAGAAGGGAAACTCGAGTTTCCCTTCTATGCTCTCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179391    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_015042.1-2599s1c1
Sequence:CCGGGCCGAACAGTTGGTTAAAGAACTCGAGTTCTTTAACCAACTGTTCGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000131108    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_015042.1-3009s1c1
Sequence:CCGGGCAGTACGAAGAACAGCAGAACTCGAGTTCTGCTGTTCTTCGTACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219872    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_015042.1-1601s1c1
Sequence:CCGGAGTACGGAGAGGAACCTATTCCTCGAGGAATAGGTTCCTCTCCGTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180097    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015042.1-5289s1c1
Sequence:CCGGCCTGTCATCTAGCCATCTGATCTCGAGATCAGATGGCTAGATGACAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015042
VALIDATED
ZNF609 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 609
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015042.1-4135s1c1
Sequence:CCGGGCACAGTACAACTTACCCTATCTCGAGATAGGGTAAGTTGTACTGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015042.1-2653s1c1
Sequence:CCGGCAGAGCAAAGACTCACCATATCTCGAGATATGGTGAGTCTTTGCTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015042.1-3930s1c1
Sequence:CCGGGAGCAAGTCTCCCACGATAAGCTCGAGCTTATCGTGGGAGACTTGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183857    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015042.1-4844s1c1
Sequence:CCGGCCCATTTACATGAGCACATATCTCGAGATATGTGCTCATGTAAATGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015042.1-1380s1c1
Sequence:CCGGCAAGCGTGTCCGTACTAATTCCTCGAGGAATTAGTACGGACACGCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000131000    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_015042.1-2794s1c1
Sequence:CCGGCCTGAGAGCATAGAAGGGAAACTCGAGTTTCCCTTCTATGCTCTCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179391    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_015042.1-2599s1c1
Sequence:CCGGGCCGAACAGTTGGTTAAAGAACTCGAGTTCTTTAACCAACTGTTCGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000131108    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_015042.1-3009s1c1
Sequence:CCGGGCAGTACGAAGAACAGCAGAACTCGAGTTCTGCTGTTCTTCGTACTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219872    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_015042.1-1601s1c1
Sequence:CCGGAGTACGGAGAGGAACCTATTCCTCGAGGAATAGGTTCCTCTCCGTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180097    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015042.1-5289s1c1
Sequence:CCGGCCTGTCATCTAGCCATCTGATCTCGAGATCAGATGGCTAGATGACAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)