EMAIL THIS PAGE TO A FRIEND

ZNF641

zinc finger protein 641

50 Gene Product Result for
UniProtKB ID: Q96N77, B3KS43, B4DNU5, Q8TCQ7, Q8WVE1
Gene ID:
cow(538714) zinc finger protein 641
sheep(101107587) zinc finger protein 641
naked mole-rat(101702494) zinc finger protein 641
domestic guinea pig(100732775) zinc finger protein 641
Horse(100051076) zinc finger protein 641
domestic cat(101089781) zinc finger protein 641
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152320 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152320 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152320 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU027851 MISSION® esiRNA esiRNA human ZNF641 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152320 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152320 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00242860 predicted 199
2 SASI_Hs01_00242861 predicted 589
3 SASI_Hs01_00242864 predicted 1458
4 SASI_Hs02_00365908 predicted 1460
5 SASI_Hs01_00242865 predicted 1075
6 SASI_Hs01_00242866 predicted 930
7 SASI_Hs01_00242867 predicted 609
8 SASI_Hs01_00242868 predicted 1493
9 SASI_Hs01_00242869 predicted 696
10 SASI_Hs02_00365909 predicted 1052
11 SASI_Hs01_00242862 predicted 1143
12 SASI_Hs01_00242863 predicted 686
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152320
VALIDATED
ZNF641 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 641
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000233027    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152320.1-999s21c1
Sequence:CCGGCCTTGCCAGGCATCAACAAACCTCGAGGTTTGTTGATGCCTGGCAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233026    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152320.1-929s21c1
Sequence:CCGGCAGAGATGGATTCCCTGTTAACTCGAGTTAACAGGGAATCCATCTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107740    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152320.1-1702s1c1
Sequence:CCGGGCATCCTACATGGGCTGATATCTCGAGATATCAGCCCATGTAGGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107744    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_152320.1-498s1c1
Sequence:CCGGCAAGGATGTGTCACTGTGCTTCTCGAGAAGCACAGTGACACATCCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152320.1-1192s1c1
Sequence:CCGGGCAGAAGGCAAATCCTGCAAACTCGAGTTTGCAGGATTTGCCTTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107742    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152320.1-779s1c1
Sequence:CCGGCCAGAATGTTATCCAGCGTGTCTCGAGACACGCTGGATAACATTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152320.1-609s1c1
Sequence:CCGGTCTGAGATTTCCAATTCCCAACTCGAGTTGGGAATTGGAAATCTCAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233024    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_152320.1-598s21c1
Sequence:CCGGATAGTAGTCTCTCTGAGATTTCTCGAGAAATCTCAGAGAGACTACTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233028    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152320.1-1835s21c1
Sequence:CCGGCTTGCATACTGTTACTATTATCTCGAGATAATAGTAACAGTATGCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233025    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152320.1-703s21c1
Sequence:CCGGGACATTCTGAGGGTCACATATCTCGAGATATGTGACCCTCAGAATGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152320
VALIDATED
ZNF641 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 641
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000233027    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152320.1-999s21c1
Sequence:CCGGCCTTGCCAGGCATCAACAAACCTCGAGGTTTGTTGATGCCTGGCAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233026    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152320.1-929s21c1
Sequence:CCGGCAGAGATGGATTCCCTGTTAACTCGAGTTAACAGGGAATCCATCTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000107740    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152320.1-1702s1c1
Sequence:CCGGGCATCCTACATGGGCTGATATCTCGAGATATCAGCCCATGTAGGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000107744    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_152320.1-498s1c1
Sequence:CCGGCAAGGATGTGTCACTGTGCTTCTCGAGAAGCACAGTGACACATCCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000107741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152320.1-1192s1c1
Sequence:CCGGGCAGAAGGCAAATCCTGCAAACTCGAGTTTGCAGGATTTGCCTTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000107742    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152320.1-779s1c1
Sequence:CCGGCCAGAATGTTATCCAGCGTGTCTCGAGACACGCTGGATAACATTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000107743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152320.1-609s1c1
Sequence:CCGGTCTGAGATTTCCAATTCCCAACTCGAGTTGGGAATTGGAAATCTCAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233024    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_152320.1-598s21c1
Sequence:CCGGATAGTAGTCTCTCTGAGATTTCTCGAGAAATCTCAGAGAGACTACTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233028    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152320.1-1835s21c1
Sequence:CCGGCTTGCATACTGTTACTATTATCTCGAGATAATAGTAACAGTATGCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233025    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152320.1-703s21c1
Sequence:CCGGGACATTCTGAGGGTCACATATCTCGAGATATGTGACCCTCAGAATGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152320
VALIDATED
ZNF641 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 641
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000233027    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152320.1-999s21c1
Sequence:CCGGCCTTGCCAGGCATCAACAAACCTCGAGGTTTGTTGATGCCTGGCAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233026    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152320.1-929s21c1
Sequence:CCGGCAGAGATGGATTCCCTGTTAACTCGAGTTAACAGGGAATCCATCTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107740    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152320.1-1702s1c1
Sequence:CCGGGCATCCTACATGGGCTGATATCTCGAGATATCAGCCCATGTAGGATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107744    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_152320.1-498s1c1
Sequence:CCGGCAAGGATGTGTCACTGTGCTTCTCGAGAAGCACAGTGACACATCCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152320.1-1192s1c1
Sequence:CCGGGCAGAAGGCAAATCCTGCAAACTCGAGTTTGCAGGATTTGCCTTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107742    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152320.1-779s1c1
Sequence:CCGGCCAGAATGTTATCCAGCGTGTCTCGAGACACGCTGGATAACATTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152320.1-609s1c1
Sequence:CCGGTCTGAGATTTCCAATTCCCAACTCGAGTTGGGAATTGGAAATCTCAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233024    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_152320.1-598s21c1
Sequence:CCGGATAGTAGTCTCTCTGAGATTTCTCGAGAAATCTCAGAGAGACTACTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233028    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152320.1-1835s21c1
Sequence:CCGGCTTGCATACTGTTACTATTATCTCGAGATAATAGTAACAGTATGCAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233025    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152320.1-703s21c1
Sequence:CCGGGACATTCTGAGGGTCACATATCTCGAGATATGTGACCCTCAGAATGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)