EMAIL THIS PAGE TO A FRIEND

ZNF92

zinc finger protein 92

31 Gene Product Result for
Synonyms: HPF12 HTF12 TF12
Species: Human ZNF92(168374)
UniProtKB ID: Q03936, A6NNF9, Q8N492, Q8NB35
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007139 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007139 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007139 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU140911 MISSION® esiRNA esiRNA human ZNF92 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007139 Rosetta Predictions human pricing
NM_152626 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007139 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00167776 predicted 419
2 SASI_Hs01_00167778 predicted 901
3 SASI_Hs01_00167779 predicted 1847
4 SASI_Hs01_00167781 predicted 901
5 SASI_Hs01_00167783 predicted 426
6 SASI_Hs01_00167784 predicted 893
7 SASI_Hs02_00343034 predicted 439
8 SASI_Hs01_00167780 predicted 604
9 SASI_Hs01_00167785 predicted 487
10 SASI_Hs01_00167777 predicted 1735
11 SASI_Hs01_00167782 predicted 929
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152626 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00166526 predicted 552
2 SASI_Hs01_00166528 predicted 1032
3 SASI_Hs01_00166529 predicted 1970
4 SASI_Hs01_00166531 predicted 1033
5 SASI_Hs01_00166533 predicted 551
6 SASI_Hs01_00166534 predicted 1020
7 SASI_Hs02_00366491 predicted 560
8 SASI_Hs01_00166530 predicted 727
9 SASI_Hs01_00166535 predicted 612
10 SASI_Hs01_00166527 predicted 1863
11 SASI_Hs01_00166532 predicted 1052
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007139
VALIDATED
ZNF92 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 92
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000430830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007139.2-431s21c1
Sequence:CCGGACTACTGACAGCAAGATATTTCTCGAGAAATATCTTGCTGTCAGTAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429266    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007139.2-1853s21c1
Sequence:CCGGGAATATGACAAGGACTTTAAACTCGAGTTTAAAGTCCTTGTCATATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417793    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007139.2-1753s21c1
Sequence:CCGGTACTAAAGAGAAACTACAAACCTCGAGGTTTGTAGTTTCTCTTTAGTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419548    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007139.2-1525s21c1
Sequence:CCGGCACTGAAGGGAAATCCTACAACTCGAGTTGTAGGATTTCCCTTCAGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019024    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_007139.2-893s1c1
Sequence:CCGGGCCTTTAACCAGTTCTCGATTCTCGAGAATCGAGAACTGGTTAAAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019026    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_007139.2-734s1c1
Sequence:CCGGCGGTCCTCAAATCTTACTAAACTCGAGTTTAGTAAGATTTGAGGACCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019028    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_007139.2-1481s1c1
Sequence:CCGGGCCTTTAACCAGTCCTCAATTCTCGAGAATTGAGGACTGGTTAAAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019027    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_007139.2-1248s1c1
Sequence:CCGGCCCTTACTGAACATAAGATAACTCGAGTTATCTTATGTTCAGTAAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019025    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_007139.2-1730s1c1
Sequence:CCGGGCCTTTAACAAATCCTCAAATCTCGAGATTTGAGGATTTGTTAAAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007139
VALIDATED
ZNF92 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 92
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000430830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007139.2-431s21c1
Sequence:CCGGACTACTGACAGCAAGATATTTCTCGAGAAATATCTTGCTGTCAGTAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429266    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007139.2-1853s21c1
Sequence:CCGGGAATATGACAAGGACTTTAAACTCGAGTTTAAAGTCCTTGTCATATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417793    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007139.2-1753s21c1
Sequence:CCGGTACTAAAGAGAAACTACAAACCTCGAGGTTTGTAGTTTCTCTTTAGTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419548    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007139.2-1525s21c1
Sequence:CCGGCACTGAAGGGAAATCCTACAACTCGAGTTGTAGGATTTCCCTTCAGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019024    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_007139.2-893s1c1
Sequence:CCGGGCCTTTAACCAGTTCTCGATTCTCGAGAATCGAGAACTGGTTAAAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019026    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_007139.2-734s1c1
Sequence:CCGGCGGTCCTCAAATCTTACTAAACTCGAGTTTAGTAAGATTTGAGGACCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019028    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_007139.2-1481s1c1
Sequence:CCGGGCCTTTAACCAGTCCTCAATTCTCGAGAATTGAGGACTGGTTAAAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019027    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_007139.2-1248s1c1
Sequence:CCGGCCCTTACTGAACATAAGATAACTCGAGTTATCTTATGTTCAGTAAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019025    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_007139.2-1730s1c1
Sequence:CCGGGCCTTTAACAAATCCTCAAATCTCGAGATTTGAGGATTTGTTAAAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007139
VALIDATED
ZNF92 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 92
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000430830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007139.2-431s21c1
Sequence:CCGGACTACTGACAGCAAGATATTTCTCGAGAAATATCTTGCTGTCAGTAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429266    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007139.2-1853s21c1
Sequence:CCGGGAATATGACAAGGACTTTAAACTCGAGTTTAAAGTCCTTGTCATATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417793    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007139.2-1753s21c1
Sequence:CCGGTACTAAAGAGAAACTACAAACCTCGAGGTTTGTAGTTTCTCTTTAGTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419548    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007139.2-1525s21c1
Sequence:CCGGCACTGAAGGGAAATCCTACAACTCGAGTTGTAGGATTTCCCTTCAGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019024    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_007139.2-893s1c1
Sequence:CCGGGCCTTTAACCAGTTCTCGATTCTCGAGAATCGAGAACTGGTTAAAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019026    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_007139.2-734s1c1
Sequence:CCGGCGGTCCTCAAATCTTACTAAACTCGAGTTTAGTAAGATTTGAGGACCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019028    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_007139.2-1481s1c1
Sequence:CCGGGCCTTTAACCAGTCCTCAATTCTCGAGAATTGAGGACTGGTTAAAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019027    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_007139.2-1248s1c1
Sequence:CCGGCCCTTACTGAACATAAGATAACTCGAGTTATCTTATGTTCAGTAAGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019025    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_007139.2-1730s1c1
Sequence:CCGGGCCTTTAACAAATCCTCAAATCTCGAGATTTGAGGATTTGTTAAAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)