EMAIL THIS PAGE TO A FRIEND

ZNRF1

zinc and ring finger 1, E3 ubiquitin protein ligase

168 Gene Product Result for
Synonyms: NIN283
UniProtKB ID: Q8ND25, D3DUJ9, Q9H083
Gene ID:
Human(84937) Summary: This gene encodes an E3 ubiquitin-protein ligase that plays a role in neural-cell differentiation. Overexpression of this gene causes neurite-like elongation. The encoded protein contains both a zinc finger and a RING finger motif and is localized in the endosome/lysosome compartment, indicating that it may be involved in ubiquitin-mediated protein modification, and in synaptic vessicle membranes in neurons. [provided by RefSeq, Feb 2012]
Mouse(170737) zinc and ring finger 1
Rat(690769) zinc and ring finger 1, E3 ubiquitin protein ligase
domestic guinea pig(100730744) zinc and ring finger 1, E3 ubiquitin protein ligase
naked mole-rat(101711624) zinc and ring finger 1, E3 ubiquitin protein ligase
cow(509076) zinc and ring finger 1
sheep(101116930) zinc and ring finger 1, E3 ubiquitin protein ligase
Zebrafish(393844) zinc and ring finger 1
domestic cat(101090067) zinc and ring finger 1, E3 ubiquitin protein ligase
chicken(425231) zinc and ring finger 1, E3 ubiquitin protein ligase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032268 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032268 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032268 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_133206 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133206 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133206 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032268 Rosetta Predictions human pricing
XM_001075556 Rosetta Predictions rat pricing
NM_133206 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032268 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00080987 predicted 1281
2 SASI_Hs01_00080988 predicted 1192
3 SASI_Hs02_00359577 predicted 1348
4 SASI_Hs01_00080990 predicted 1272
5 SASI_Hs01_00080991 predicted 934
6 SASI_Hs02_00359578 predicted 930
7 SASI_Hs01_00080993 predicted 1059
8 SASI_Hs01_00080994 predicted 1171
9 SASI_Hs02_00359579 predicted 1062
10 SASI_Hs02_00359580 predicted 1304
11 SASI_Hs01_00080989 predicted 1130
12 SASI_Hs01_00080992 predicted 1323
13 SASI_Hs01_00080995 predicted 1291
14 SASI_Hs01_00080996 predicted 1346
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001075556 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00350228 predicted 311
2 SASI_Rn02_00350229 predicted 291
3 SASI_Rn02_00350230 predicted 287
4 SASI_Rn02_00350231 predicted 318
5 SASI_Rn02_00350232 predicted 134
6 SASI_Rn02_00350233 predicted 255
7 SASI_Rn02_00350234 predicted 394
8 SASI_Rn02_00350235 predicted 355
9 SASI_Rn02_00350236 predicted 308
10 SASI_Rn02_00350237 predicted 219
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133206 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00134380 predicted 755
2 SASI_Mm01_00134381 predicted 1208
3 SASI_Mm01_00134382 predicted 1354
4 SASI_Mm01_00134383 predicted 1030
5 SASI_Mm01_00134384 predicted 759
6 SASI_Mm02_00338399 predicted 916
7 SASI_Mm01_00134385 predicted 1038
8 SASI_Mm01_00134386 predicted 1351
9 SASI_Mm01_00134387 predicted 1194
10 SASI_Mm01_00134388 predicted 1395
11 SASI_Mm01_00134389 predicted 1370
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032268
VALIDATED
ZNRF1 MISSION shRNA Bacterial Glycerol Stock
zinc and ring finger 1, E3 ubiquitin protein ligase
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000073043    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032268.3-1916s1c1
Sequence:CCGGCCCTAATATCTTGACTTCATTCTCGAGAATGAAGTCAAGATATTAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032268.3-1066s1c1
Sequence:CCGGCAGCTCGCATAGTGGTTTCAACTCGAGTTGAAACCACTATGCGAGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032268.3-1119s1c1
Sequence:CCGGACGAGATGGAAATGCACTTTACTCGAGTAAAGTGCATTTCCATCTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073044    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_032268.3-1170s1c1
Sequence:CCGGACAACGATGATGTGCTGACTACTCGAGTAGTCAGCACATCATCGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073045    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_032268.3-1120s1c1
Sequence:CCGGCGAGATGGAAATGCACTTTATCTCGAGATAAAGTGCATTTCCATCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307784    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032268.4-1066s21c1
Sequence:CCGGCAGCTCGCATAGTGGTTTCAACTCGAGTTGAAACCACTATGCGAGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291875    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032268.4-1170s21c1
Sequence:CCGGACAACGATGATGTGCTGACTACTCGAGTAGTCAGCACATCATCGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291874    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032268.4-1120s21c1
Sequence:CCGGCGAGATGGAAATGCACTTTATCTCGAGATAAAGTGCATTTCCATCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303298    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032268.4-1493s21c1
Sequence:CCGGCCTCCCTGAGGACACCAAATTCTCGAGAATTTGGTGTCCTCAGGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303362    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032268.4-944s21c1
Sequence:CCGGTATGCCCATGGCAATGGTTACCTCGAGGTAACCATTGCCATGGGCATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032268
VALIDATED
ZNRF1 MISSION shRNA shRNA Plasmid DNA
zinc and ring finger 1, E3 ubiquitin protein ligase
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000073043    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032268.3-1916s1c1
Sequence:CCGGCCCTAATATCTTGACTTCATTCTCGAGAATGAAGTCAAGATATTAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032268.3-1066s1c1
Sequence:CCGGCAGCTCGCATAGTGGTTTCAACTCGAGTTGAAACCACTATGCGAGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032268.3-1119s1c1
Sequence:CCGGACGAGATGGAAATGCACTTTACTCGAGTAAAGTGCATTTCCATCTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073044    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_032268.3-1170s1c1
Sequence:CCGGACAACGATGATGTGCTGACTACTCGAGTAGTCAGCACATCATCGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073045    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_032268.3-1120s1c1
Sequence:CCGGCGAGATGGAAATGCACTTTATCTCGAGATAAAGTGCATTTCCATCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000307784    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032268.4-1066s21c1
Sequence:CCGGCAGCTCGCATAGTGGTTTCAACTCGAGTTGAAACCACTATGCGAGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291875    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032268.4-1170s21c1
Sequence:CCGGACAACGATGATGTGCTGACTACTCGAGTAGTCAGCACATCATCGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291874    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032268.4-1120s21c1
Sequence:CCGGCGAGATGGAAATGCACTTTATCTCGAGATAAAGTGCATTTCCATCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000303298    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032268.4-1493s21c1
Sequence:CCGGCCTCCCTGAGGACACCAAATTCTCGAGAATTTGGTGTCCTCAGGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000303362    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032268.4-944s21c1
Sequence:CCGGTATGCCCATGGCAATGGTTACCTCGAGGTAACCATTGCCATGGGCATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032268
VALIDATED
ZNRF1 MISSION shRNA Lentiviral Transduction Particles
zinc and ring finger 1, E3 ubiquitin protein ligase
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000073043    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032268.3-1916s1c1
Sequence:CCGGCCCTAATATCTTGACTTCATTCTCGAGAATGAAGTCAAGATATTAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032268.3-1066s1c1
Sequence:CCGGCAGCTCGCATAGTGGTTTCAACTCGAGTTGAAACCACTATGCGAGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032268.3-1119s1c1
Sequence:CCGGACGAGATGGAAATGCACTTTACTCGAGTAAAGTGCATTTCCATCTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073044    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_032268.3-1170s1c1
Sequence:CCGGACAACGATGATGTGCTGACTACTCGAGTAGTCAGCACATCATCGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073045    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_032268.3-1120s1c1
Sequence:CCGGCGAGATGGAAATGCACTTTATCTCGAGATAAAGTGCATTTCCATCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307784    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032268.4-1066s21c1
Sequence:CCGGCAGCTCGCATAGTGGTTTCAACTCGAGTTGAAACCACTATGCGAGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291875    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032268.4-1170s21c1
Sequence:CCGGACAACGATGATGTGCTGACTACTCGAGTAGTCAGCACATCATCGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291874    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032268.4-1120s21c1
Sequence:CCGGCGAGATGGAAATGCACTTTATCTCGAGATAAAGTGCATTTCCATCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303298    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032268.4-1493s21c1
Sequence:CCGGCCTCCCTGAGGACACCAAATTCTCGAGAATTTGGTGTCCTCAGGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303362    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032268.4-944s21c1
Sequence:CCGGTATGCCCATGGCAATGGTTACCTCGAGGTAACCATTGCCATGGGCATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133206
ZNRF1 MISSION shRNA Bacterial Glycerol Stock
zinc and ring finger 1, E3 ubiquitin protein ligase
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000040743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133206.1-844s1c1
Sequence:CCGGCATGGTTTGAAGTGAACAGATCTCGAGATCTGTTCACTTCAAACCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133206.1-721s1c1
Sequence:CCGGACAATGATGATGTGCTGACTACTCGAGTAGTCAGCACATCATCATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133206.1-810s1c1
Sequence:CCGGTGCCTGTGCATCTATCACAAACTCGAGTTTGTGATAGATGCACAGGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133206.1-530s1c1
Sequence:CCGGCGGTCACCATAGAGACGGGATCTCGAGATCCCGTCTCTATGGTGACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133206.1-672s1c1
Sequence:CCGGGAGATGGAAATGCACTTTATACTCGAGTATAAAGTGCATTTCCATCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133206
ZNRF1 MISSION shRNA shRNA Plasmid DNA
zinc and ring finger 1, E3 ubiquitin protein ligase
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000040743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133206.1-844s1c1
Sequence:CCGGCATGGTTTGAAGTGAACAGATCTCGAGATCTGTTCACTTCAAACCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133206.1-721s1c1
Sequence:CCGGACAATGATGATGTGCTGACTACTCGAGTAGTCAGCACATCATCATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133206.1-810s1c1
Sequence:CCGGTGCCTGTGCATCTATCACAAACTCGAGTTTGTGATAGATGCACAGGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133206.1-530s1c1
Sequence:CCGGCGGTCACCATAGAGACGGGATCTCGAGATCCCGTCTCTATGGTGACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133206.1-672s1c1
Sequence:CCGGGAGATGGAAATGCACTTTATACTCGAGTATAAAGTGCATTTCCATCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133206
ZNRF1 MISSION shRNA Lentiviral Transduction Particles
zinc and ring finger 1, E3 ubiquitin protein ligase
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000040743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133206.1-844s1c1
Sequence:CCGGCATGGTTTGAAGTGAACAGATCTCGAGATCTGTTCACTTCAAACCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133206.1-721s1c1
Sequence:CCGGACAATGATGATGTGCTGACTACTCGAGTAGTCAGCACATCATCATTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133206.1-810s1c1
Sequence:CCGGTGCCTGTGCATCTATCACAAACTCGAGTTTGTGATAGATGCACAGGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133206.1-530s1c1
Sequence:CCGGCGGTCACCATAGAGACGGGATCTCGAGATCCCGTCTCTATGGTGACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133206.1-672s1c1
Sequence:CCGGGAGATGGAAATGCACTTTATACTCGAGTATAAAGTGCATTTCCATCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)