EMAIL THIS PAGE TO A FRIEND

ZNRF2P1

zinc and ring finger 2 pseudogene 1

13 Gene Product Result for
Species: Human ZNRF2P1(441208)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001013723 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001013723 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001013723 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001013723 Rosetta Predictions human pricing
NR_003502 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013723 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00204547 predicted 440
siRNA
PRODUCT # siRNA Type ? SPECIES
NR_003502 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00379317 predicted 1050
2 SASI_Hs02_00379318 predicted 1412
3 SASI_Hs02_00379319 predicted 1483
4 SASI_Hs02_00379320 predicted 1596
5 SASI_Hs02_00379321 predicted 1416
6 SASI_Hs02_00379322 predicted 1055
7 SASI_Hs02_00379323 predicted 1479
8 SASI_Hs02_00379324 predicted 1569
9 SASI_Hs02_00379325 predicted 1618
10 SASI_Hs02_00379326 predicted 1494
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001013723
ZNRF2P1 MISSION shRNA Bacterial Glycerol Stock
zinc and ring finger 2 pseudogene 1
Human
2 Products Total
TRC Number Price Set Price (2)? Select
TRCN0000167491    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013723.1-1320s1c1
Sequence:CCGGGAACTCTGAGTTACCATCTTTCTCGAGAAAGATGGTAACTCAGAGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167328    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013723.1-1391s1c1
Sequence:CCGGCCACTTACTATGTCACTTTAACTCGAGTTAAAGTGACATAGTAAGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001013723
ZNRF2P1 MISSION shRNA shRNA Plasmid DNA
zinc and ring finger 2 pseudogene 1
Human
2 Products Total
TRC Number Vector Price Set Price (2)? Select
TRCN0000167491    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013723.1-1320s1c1
Sequence:CCGGGAACTCTGAGTTACCATCTTTCTCGAGAAAGATGGTAACTCAGAGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167328    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013723.1-1391s1c1
Sequence:CCGGCCACTTACTATGTCACTTTAACTCGAGTTAAAGTGACATAGTAAGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001013723
ZNRF2P1 MISSION shRNA Lentiviral Transduction Particles
zinc and ring finger 2 pseudogene 1
Human
2 Products Total
TRC Number Volume Titer Vector Price Set Price (2)? Select
TRCN0000167491    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013723.1-1320s1c1
Sequence:CCGGGAACTCTGAGTTACCATCTTTCTCGAGAAAGATGGTAACTCAGAGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167328    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013723.1-1391s1c1
Sequence:CCGGCCACTTACTATGTCACTTTAACTCGAGTTAAAGTGACATAGTAAGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)