EMAIL THIS PAGE TO A FRIEND

ZPLD1

zona pellucida-like domain containing 1

181 Gene Product Result for
UniProtKB ID: Q8TCW7, Q49AS1, Q8WU36
Gene ID:
Mouse(239852) zona pellucida like domain containing 1
Rat(363768) zona pellucida-like domain containing 1
chicken(418405) zona pellucida-like domain containing 1
domestic cat(101096592) zona pellucida-like domain containing 1
dog(487958) zona pellucida-like domain containing 1
cow(527953) zona pellucida-like domain containing 1
sheep(101113639) zona pellucida-like domain containing 1
naked mole-rat(101724717) zona pellucida-like domain containing 1
domestic guinea pig(100718310) zona pellucida-like domain containing 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178720 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178720 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178720 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_175056 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_175056 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_175056 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU050971 MISSION® esiRNA esiRNA human ZPLD1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_175056 Rosetta Predictions human pricing
XM_001062705 Rosetta Predictions rat pricing
XM_344016 Rosetta Predictions rat pricing
NM_178720 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175056 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00134977 predicted 1073
2 SASI_Hs01_00134978 predicted 1484
3 SASI_Hs01_00134979 predicted 578
4 SASI_Hs02_00368953 predicted 399
5 SASI_Hs02_00368954 predicted 686
6 SASI_Hs01_00134981 predicted 873
7 SASI_Hs01_00134982 predicted 618
8 SASI_Hs01_00134983 predicted 1358
9 SASI_Hs02_00368955 predicted 522
10 SASI_Hs01_00134986 predicted 1279
11 SASI_Hs01_00134980 predicted 599
12 SASI_Hs01_00134984 predicted 708
13 SASI_Hs01_00134985 predicted 1189
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001062705 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00304312 predicted 1237
2 SASI_Rn02_00304313 predicted 467
3 SASI_Rn02_00304314 predicted 861
4 SASI_Rn02_00304315 predicted 730
5 SASI_Rn02_00304316 predicted 1682
6 SASI_Rn02_00304317 predicted 958
7 SASI_Rn02_00304318 predicted 1797
8 SASI_Rn02_00304319 predicted 1016
9 SASI_Rn02_00304320 predicted 877
10 SASI_Rn02_00304321 predicted 1031
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_344016 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00396684 predicted 475
2 SASI_Rn02_00396685 predicted 930
3 SASI_Rn02_00396686 predicted 855
4 SASI_Rn02_00396687 predicted 735
5 SASI_Rn02_00396688 predicted 964
6 SASI_Rn02_00396689 predicted 803
7 SASI_Rn02_00396690 predicted 787
8 SASI_Rn02_00396691 predicted 878
9 SASI_Rn02_00396692 predicted 259
10 SASI_Rn02_00396693 predicted 522
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178720 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00349228 predicted 1332
2 SASI_Mm02_00349229 predicted 210
3 SASI_Mm02_00349230 predicted 245
4 SASI_Mm02_00349231 predicted 1291
5 SASI_Mm02_00349232 predicted 1086
6 SASI_Mm02_00349233 predicted 982
7 SASI_Mm02_00349234 predicted 1356
8 SASI_Mm02_00349235 predicted 473
9 SASI_Mm02_00349236 predicted 513
10 SASI_Mm02_00349237 predicted 608
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178720
ZPLD1 MISSION shRNA Bacterial Glycerol Stock
zona pellucida-like domain containing 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000246445    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178720.4-1280s21c1
Sequence:CCGGTGATATCAGGAATGGTCATTCCTCGAGGAATGACCATTCCTGATATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246447    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178720.4-631s21c1
Sequence:CCGGCCGTTGGAATACCTGGTTAATCTCGAGATTAACCAGGTATTCCAACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246446    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178720.4-2230s21c1
Sequence:CCGGGACATTGTCAGCACCATATAACTCGAGTTATATGGTGCTGACAATGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246449    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178720.4-760s21c1
Sequence:CCGGCAATTAATTATCCCGAGTATACTCGAGTATACTCGGGATAATTAATTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246448    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178720.4-301s21c1
Sequence:CCGGGCCATTACGATGAAGATTAATCTCGAGATTAATCTTCATCGTAATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178720
ZPLD1 MISSION shRNA shRNA Plasmid DNA
zona pellucida-like domain containing 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000246445    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178720.4-1280s21c1
Sequence:CCGGTGATATCAGGAATGGTCATTCCTCGAGGAATGACCATTCCTGATATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246447    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178720.4-631s21c1
Sequence:CCGGCCGTTGGAATACCTGGTTAATCTCGAGATTAACCAGGTATTCCAACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246446    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178720.4-2230s21c1
Sequence:CCGGGACATTGTCAGCACCATATAACTCGAGTTATATGGTGCTGACAATGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246449    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178720.4-760s21c1
Sequence:CCGGCAATTAATTATCCCGAGTATACTCGAGTATACTCGGGATAATTAATTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246448    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178720.4-301s21c1
Sequence:CCGGGCCATTACGATGAAGATTAATCTCGAGATTAATCTTCATCGTAATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178720
ZPLD1 MISSION shRNA Lentiviral Transduction Particles
zona pellucida-like domain containing 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000246445    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178720.4-1280s21c1
Sequence:CCGGTGATATCAGGAATGGTCATTCCTCGAGGAATGACCATTCCTGATATCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246447    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178720.4-631s21c1
Sequence:CCGGCCGTTGGAATACCTGGTTAATCTCGAGATTAACCAGGTATTCCAACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246446    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178720.4-2230s21c1
Sequence:CCGGGACATTGTCAGCACCATATAACTCGAGTTATATGGTGCTGACAATGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246449    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178720.4-760s21c1
Sequence:CCGGCAATTAATTATCCCGAGTATACTCGAGTATACTCGGGATAATTAATTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246448    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178720.4-301s21c1
Sequence:CCGGGCCATTACGATGAAGATTAATCTCGAGATTAATCTTCATCGTAATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175056
ZPLD1 MISSION shRNA Bacterial Glycerol Stock
zona pellucida-like domain containing 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000430195    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175056.1-621s21c1
Sequence:CCGGCATTGGAATACCTGGTTAATACTCGAGTATTAACCAGGTATTCCAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175056.1-1203s1c1
Sequence:CCGGCCAACAATTCGCAACTTGGTTCTCGAGAACCAAGTTGCGAATTGTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175056.1-563s1c1
Sequence:CCGGCCACCAACAATCATCAGCTATCTCGAGATAGCTGATGATTGTTGGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175056.1-286s1c1
Sequence:CCGGGCAGGCTATTACGATGAAGATCTCGAGATCTTCATCGTAATAGCCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175056.1-172s1c1
Sequence:CCGGGCTTCTAACAATTAGAGTGCTCTCGAGAGCACTCTAATTGTTAGAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175056.1-1349s1c1
Sequence:CCGGCCCACAAGTTTAGTGTTGAATCTCGAGATTCAACACTAAACTTGTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128401    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175056.1-2337s1c1
Sequence:CCGGGCAGAACATTGTTGGAATCTACTCGAGTAGATTCCAACAATGTTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129018    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175056.1-1868s1c1
Sequence:CCGGGCCAATTTGGATACCTGAGATCTCGAGATCTCAGGTATCCAAATTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175056.1-1278s1c1
Sequence:CCGGGAATGGTCATTCTGGGAGTTACTCGAGTAACTCCCAGAATGACCATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175056
ZPLD1 MISSION shRNA shRNA Plasmid DNA
zona pellucida-like domain containing 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000430195    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175056.1-621s21c1
Sequence:CCGGCATTGGAATACCTGGTTAATACTCGAGTATTAACCAGGTATTCCAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175056.1-1203s1c1
Sequence:CCGGCCAACAATTCGCAACTTGGTTCTCGAGAACCAAGTTGCGAATTGTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175056.1-563s1c1
Sequence:CCGGCCACCAACAATCATCAGCTATCTCGAGATAGCTGATGATTGTTGGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175056.1-286s1c1
Sequence:CCGGGCAGGCTATTACGATGAAGATCTCGAGATCTTCATCGTAATAGCCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175056.1-172s1c1
Sequence:CCGGGCTTCTAACAATTAGAGTGCTCTCGAGAGCACTCTAATTGTTAGAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175056.1-1349s1c1
Sequence:CCGGCCCACAAGTTTAGTGTTGAATCTCGAGATTCAACACTAAACTTGTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128401    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175056.1-2337s1c1
Sequence:CCGGGCAGAACATTGTTGGAATCTACTCGAGTAGATTCCAACAATGTTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129018    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175056.1-1868s1c1
Sequence:CCGGGCCAATTTGGATACCTGAGATCTCGAGATCTCAGGTATCCAAATTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175056.1-1278s1c1
Sequence:CCGGGAATGGTCATTCTGGGAGTTACTCGAGTAACTCCCAGAATGACCATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175056
ZPLD1 MISSION shRNA Lentiviral Transduction Particles
zona pellucida-like domain containing 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000430195    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175056.1-621s21c1
Sequence:CCGGCATTGGAATACCTGGTTAATACTCGAGTATTAACCAGGTATTCCAATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175056.1-1203s1c1
Sequence:CCGGCCAACAATTCGCAACTTGGTTCTCGAGAACCAAGTTGCGAATTGTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175056.1-563s1c1
Sequence:CCGGCCACCAACAATCATCAGCTATCTCGAGATAGCTGATGATTGTTGGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175056.1-286s1c1
Sequence:CCGGGCAGGCTATTACGATGAAGATCTCGAGATCTTCATCGTAATAGCCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175056.1-172s1c1
Sequence:CCGGGCTTCTAACAATTAGAGTGCTCTCGAGAGCACTCTAATTGTTAGAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175056.1-1349s1c1
Sequence:CCGGCCCACAAGTTTAGTGTTGAATCTCGAGATTCAACACTAAACTTGTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128401    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175056.1-2337s1c1
Sequence:CCGGGCAGAACATTGTTGGAATCTACTCGAGTAGATTCCAACAATGTTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129018    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175056.1-1868s1c1
Sequence:CCGGGCCAATTTGGATACCTGAGATCTCGAGATCTCAGGTATCCAAATTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175056.1-1278s1c1
Sequence:CCGGGAATGGTCATTCTGGGAGTTACTCGAGTAACTCCCAGAATGACCATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)