EMAIL THIS PAGE TO A FRIEND

ZSCAN1

zinc finger and SCAN domain containing 1

21 Gene Product Result for
Synonyms: MZF-1 ZNF915
Species: Human ZSCAN1(284312)
UniProtKB ID: Q8NBB4, Q3B798, Q6WLH8, Q86WS8
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_182572 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_182572 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_182572 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU130391 MISSION® esiRNA esiRNA human ZSCAN1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_182572 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182572 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00210753 predicted 706
2 SASI_Hs01_00210754 predicted 1705
3 SASI_Hs01_00210755 predicted 1040
4 SASI_Hs01_00210756 predicted 1068
5 SASI_Hs01_00210757 predicted 961
6 SASI_Hs01_00210758 predicted 896
7 SASI_Hs01_00210759 predicted 1154
8 SASI_Hs01_00210761 predicted 1157
9 SASI_Hs02_00370700 predicted 614
10 SASI_Hs02_00370701 predicted 1602
11 SASI_Hs01_00210760 predicted 1729
12 SASI_Hs01_00210762 predicted 1731
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_182572
ZSCAN1 MISSION shRNA Bacterial Glycerol Stock
zinc finger and SCAN domain containing 1
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000432013    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182572.3-1072s21c1
Sequence:CCGGTGTTGCAGGCATCTCGGTAGTCTCGAGACTACCGAGATGCCTGCAACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182572.2-1034s1c1
Sequence:CCGGCCATCCCTCAAGCACACCAAACTCGAGTTTGGTGTGCTTGAGGGATGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422296    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182572.3-1600s21c1
Sequence:CCGGCACAAGCTGTTTCTCGGAAGACTCGAGTCTTCCGAGAAACAGCTTGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182572.3-602s21c1
Sequence:CCGGATGTGCCAGCAGGAAGTTCTGCTCGAGCAGAACTTCCTGCTGGCACATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182572.2-679s1c1
Sequence:CCGGGAAGAGTCCAAGGTCCCAGAACTCGAGTTCTGGGACCTTGGACTCTTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182572.2-1162s1c1
Sequence:CCGGCCACTTCATCGAGCACCAGAACTCGAGTTCTGGTGCTCGATGAAGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_182572
ZSCAN1 MISSION shRNA shRNA Plasmid DNA
zinc finger and SCAN domain containing 1
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000432013    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182572.3-1072s21c1
Sequence:CCGGTGTTGCAGGCATCTCGGTAGTCTCGAGACTACCGAGATGCCTGCAACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182572.2-1034s1c1
Sequence:CCGGCCATCCCTCAAGCACACCAAACTCGAGTTTGGTGTGCTTGAGGGATGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422296    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182572.3-1600s21c1
Sequence:CCGGCACAAGCTGTTTCTCGGAAGACTCGAGTCTTCCGAGAAACAGCTTGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182572.3-602s21c1
Sequence:CCGGATGTGCCAGCAGGAAGTTCTGCTCGAGCAGAACTTCCTGCTGGCACATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182572.2-679s1c1
Sequence:CCGGGAAGAGTCCAAGGTCCCAGAACTCGAGTTCTGGGACCTTGGACTCTTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182572.2-1162s1c1
Sequence:CCGGCCACTTCATCGAGCACCAGAACTCGAGTTCTGGTGCTCGATGAAGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_182572
ZSCAN1 MISSION shRNA Lentiviral Transduction Particles
zinc finger and SCAN domain containing 1
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000432013    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182572.3-1072s21c1
Sequence:CCGGTGTTGCAGGCATCTCGGTAGTCTCGAGACTACCGAGATGCCTGCAACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182572.2-1034s1c1
Sequence:CCGGCCATCCCTCAAGCACACCAAACTCGAGTTTGGTGTGCTTGAGGGATGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422296    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182572.3-1600s21c1
Sequence:CCGGCACAAGCTGTTTCTCGGAAGACTCGAGTCTTCCGAGAAACAGCTTGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182572.3-602s21c1
Sequence:CCGGATGTGCCAGCAGGAAGTTCTGCTCGAGCAGAACTTCCTGCTGGCACATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182572.2-679s1c1
Sequence:CCGGGAAGAGTCCAAGGTCCCAGAACTCGAGTTCTGGGACCTTGGACTCTTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182572.2-1162s1c1
Sequence:CCGGCCACTTCATCGAGCACCAGAACTCGAGTTCTGGTGCTCGATGAAGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)