EMAIL THIS PAGE TO A FRIEND
EHUEGFP Sigma-Aldrich

MISSION® esiRNA

esiRNA targeting EGFP (esiRNA1)

  •  NACRES NA.51

Purchase

Properties

Related Categories DSG-ES, Fast esiRNA & Controls, Functional Genomics and RNAi, Human Genes, Human esiRNA,
Quality Level   100
description   Powered by Eupheria Biotech
product line   MISSION®
concentration   200 ng/μL RNA
shipped in   dry ice
storage temp.   −20°C

Description

General description

EHUEGFP targets enhanced Green Fluorescent Protein (i.e. eGFP). It can be used as a negative control in systems lacking eGFP, or a positive knockdown control in systems expressing it.

MISSION esiRNA are endo-ribonuclease prepared siRNA. MISSION esiRNA are a heterogeneous mixture of siRNAs that all target the same mRNA sequence. These multiple silencing triggers lead to highly specific and effective gene silencing.

esiRNA Custom options:
ESISEC: Secondary independent esiRNA for any human or mouse esiRNA
ESIOPEN: Custom esiRNA targeting species specific sequence provided
Contact your local sales rep. or email us at Custom esiRNA for more information.

Physical form

Solution in low-TE (10 mM Tris-HCl, pH 8.0, 1 mM EDTA)

Other Notes

View the esiRNA screening tutorial.

esiRNA cDNA target sequence: GTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACGAGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCATGGACGAGCTGTA

Legal Information

MISSION is a registered trademark of Sigma-Aldrich Co. LLC

Safety & Documentation

Safety Information

RIDADR 
NONH for all modes of transport
Protocols & Articles
Peer-Reviewed Papers
15

References

Related Products

related product

Product #

Description

Add to Cart

06693 Timestrip Plus -20 °C

Technical Service:

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Bulk Ordering & Pricing:

Need larger quantities for your development, manufacturing or research applications?