• USA Home
  • EHNC025741 - MISSION® esiRNA

EMAIL THIS PAGE TO A FRIEND
EHNC025741 Sigma-Aldrich

MISSION® esiRNA

New

targeting human WFDC21P

Purchase

Properties

form   lyophilized
  lyophilized powder
esiRNA cDNA target sequence   CCTAAGATCGTCATCCCTTCCTGGAGTTCCTATCTTCCAAGATGTGACTGTCTGGAGTTCCTTGACTAGGAAGATGGATGAAAACAGCAAGCCTGTGGATGGAGACTACAGGGGATATGGGAGGCAGGGAAGAGGGGTTGTTTCTTTTAA
shipped in   ambient
storage temp.   −20°C

Description

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Sigma-Aldrich Co. LLC

Safety & Documentation

Safety Information

Safety Information for this product is unavailable at this time.

Documents

Certificate of Analysis (COA)

Please Enter a Lot Number
Protocols & Articles
Related Products

Technical Service:

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Bulk Ordering & Pricing:

Need larger quantities for your development, manufacturing or research applications?