EMAIL THIS PAGE TO A FRIEND
EHU053891 Sigma-Aldrich

MISSION® esiRNA

targeting human TET1

  •  NACRES NA.51

Purchase

Properties

Related Categories Cancer Metabolism, Cancer Research, Cell Biology, Fast esiRNA & Controls, Functional Genomics and RNAi,
Quality Level   100
description   Powered by Eupheria Biotech
product line   MISSION®
form   lyophilized powder
esiRNA cDNA target sequence   AAAAGACCTCCAAGACCCAAACTTACAGGGAGAGCCACCAAAACTTAATCACTGTCCATCTTTGGAAAAACAAAGTTCATGCAACACGGTGGTTTTCAATGGGCAAACTACTACCCTTTCCAACTCACATATCAACTCAGCTACTAACCAAGCATCCACAAAGTCACATGAATATTCAAAAGTCACAAATTCATTATCTCTTTTTATACCAAAATCAAATTCATCCAAGATTGACACCAATAAAAGTATTGCTCAAGGGATAATTACTCTTGACAATTGTTCCAATGATTTGCATCAGTTGCCACCAAGAAATAATGAAGTGGAGTATTGCAACCAGTTACTGGACAGCAGCAAAAAATTGGACTCAGATGATCTATCATGTCAGGATGCAACCCATACC
Ensembl | human accession no.   ENSG00000138336
NCBI accession no.   NM_030625
shipped in   ambient
storage temp.   −20°C
Gene Information   human ... TET1(80312), TET1(80312)

Description

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Sigma-Aldrich Co. LLC

Safety & Documentation

Safety Information

RIDADR 
NONH for all modes of transport
Flash Point(F) 
Not applicable
Flash Point(C) 
Not applicable
Protocols & Articles

Articles

LCMS Separation and Identification of 2-Hydroxyglutarates

Sigma-Aldrich has recently developed an application for the separation and identification of S-2-hydroxyglutaric acids and R-2-hydroxyglutaric acids by chiral LC-MS, using a CHIROBIOTIC® R Column (co...
Keywords: AGE, Cancer, High performance liquid chromatography, Liquid chromatography mass spectrometry, Mass spectrometry, Metabolism, Reductions, Separation, Tools

Peer-Reviewed Papers
15

References

Related Products

Technical Service:

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Bulk Ordering & Pricing:

Need larger quantities for your development, manufacturing or research applications?