EMAIL THIS PAGE TO A FRIEND
EHU061261 Sigma-Aldrich

MISSION® esiRNA

esiRNA human RGS11 (esiRNA1)

Purchase

Properties

Related Categories Functional Genomics and RNAi, Human esiRNA, MISSION esiRNA Technology, Molecular Biology, RD-RPK More...
description   Powered by Eupheria Biotech
product line   MISSION®
concentration   200 ng/μL RNA
esiRNA cDNA target sequence   GCAATCCCTGGATCTCAGACAATGACGCCTACTGGGTCATGAATGCCCCCACGGTGGCTGCCCCCACGAAGCTCCGTGTGGAGAGATGGGGCTTCAGCTTCCGGGAGCTCCTGGAGGACCCCGTGGGGCGGGCCCACTTCATGGACTTTCTGGGAAAGGAGTTCAGTGGAGAAAACCTCAGCTTCTGGGAGGCATGTGAGGAGCTTCGATATGGAGCGCAGGCCCAGGTCCCCACCCTGGTGGATGCCGTGTACGAGCAGTTCCTGGCCCCCGGAGCTGCCCACTGGGTCAACATCGACAGCCGGACCATGGAGCAGACCCTGGAGGGGCTGCGCCAGCCCCACCGCTATGTCCTGGATGACGCCCAGCTGCACATATACATGCTCATGAAGAAGGACTCCTACCCAAGGTTCCTGAA
Ensembl | human accession no.   ENSG00000076344
NCBI accession no.   NM_183337
shipped in   dry ice
storage temp.   −20°C
Gene Information   human ... RGS11(8786)

Description

General description

MISSION esiRNA are endo-ribonuclease prepared siRNA. MISSION esiRNA are a heterogeneous mixture of siRNAs that all target the same mRNA sequence. These multiple silencing triggers lead to highly specific and effective gene silencing.

To view this esiRNA screening tutorial, vist.

esiRNA Custom options:
ESISEC: Secondary independent esiRNA for any human or mouse esiRNA
ESIOPEN: Custom esiRNA targeting species specific sequence provided
Contact your local sales rep. or email us at Custom esiRNA for more information.

Physical form

Solution in low-TE (Tris-HCl (10 mM final), EDTA (1 mM final), pH to 8.0.

Legal Information

MISSION is a registered trademark of Sigma-Aldrich Co. LLC

Safety & Documentation

Safety Information

RIDADR 
NONH for all modes of transport

Documents

Certificate of Analysis (COA)

Please Enter a Lot Number
Protocols & Articles
Related Products

Technical Service:

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Bulk Ordering & Pricing:

Need larger quantities for your development, manufacturing or research applications?