EMAIL THIS PAGE TO A FRIEND
EHU075381 Sigma-Aldrich

MISSION® esiRNA

esiRNA human ADAM17 (esiRNA1)

Purchase

Properties

Related Categories AC09-AE0, Fast esiRNA & Controls, Functional Genomics and RNAi, Human Genes, Human esiRNA,
description   Powered by Eupheria Biotech
product line   MISSION®
concentration   200 ng/μL RNA
esiRNA cDNA target sequence   TGGTTGGTGAGCCTGACTCTAGGGTTCTAGCCCACATAAGAGATGATGATGTTATAATCAGAATCAACACAGATGGGGCCGAATATAACATAGAGCCACTTTGGAGATTTGTTAATGATACCAAAGACAAAAGAATGTTAGTTTATAAATCTGAAGATATCAAGAATGTTTCACGTTTGCAGTCTCCAAAAGTGTGTGGTTATTTAAAAGTGGATAATGAAGAGTTGCTCCCAAAAGGGTTAGTAGACAGAGAACCACCTGAAGAGCTTGTTCATCGAGTGAAAAGAAGAGCTGACCCAGATCCCATGAAGAACACGTGTAAATTATTGGTGGTAGCAGATCATCGCTTCTACAGATACATGGGCAGAGGGGAAGAGAGTACAACTACAAATTACTTAATAGAGCTAATTGACAGAGTTGATGACATCTATCGGAACACTTCATGGG
Ensembl | human accession no.   ENSG00000151694
NCBI accession no.   NM_003183
shipped in   dry ice
storage temp.   −20°C
Gene Information   human ... ADAM17(6868)

Description

General description

MISSION esiRNA are endo-ribonuclease prepared siRNA. MISSION esiRNA are a heterogeneous mixture of siRNAs that all target the same mRNA sequence. These multiple silencing triggers lead to highly specific and effective gene silencing.

To view this esiRNA screening tutorial, vist.

esiRNA Custom options:
ESISEC: Secondary independent esiRNA for any human or mouse esiRNA
ESIOPEN: Custom esiRNA targeting species specific sequence provided
Contact your local sales rep. or email us at Custom esiRNA for more information.

Physical form

Solution in low-TE (Tris-HCl (10 mM final), EDTA (1 mM final), pH to 8.0.

Legal Information

MISSION is a registered trademark of Sigma-Aldrich Co. LLC

Safety & Documentation

Safety Information

RIDADR 
NONH for all modes of transport

Documents

Certificate of Analysis

???PDP_SDS_LOT_NUMBER_ERROR_MSG???
Protocols & Articles
Peer-Reviewed Papers
15

References

Related Products

Technical Service:

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Bulk Ordering & Pricing:

Need larger quantities for your development, manufacturing or research applications?