EMAIL THIS PAGE TO A FRIEND
EHU091361 Sigma-Aldrich

MISSION® esiRNA

targeting human MRE11

  •  NACRES NA.51

Purchase

Properties

Related Categories Fast esiRNA & Controls, Functional Genomics and RNAi, Human Genes, Human esiRNA, MISSION esiRNA Technology,
Quality Level   100
description   Powered by Eupheria Biotech
product line   MISSION®
form   lyophilized powder
esiRNA cDNA target sequence   TCCTCTGTAAAAAGATCCCTGAGATTATTCCTTCTTCTAGTTTTATGCGACAGCTTTACTTTAAAATTCAAGTTATACATCTTGGGAGTACAATGGCCCGACATTTCTTCATAGGTAGAAACAAATACTTGACTCAGTGATACTCATGACCATTAGAATAGTCATACCTGGAATGTGTCAAATTATAAGAGACAGACACTTGGTTAGTGGCTGCCTCATATAGCACTTTTGAAGAGGCCTAAGTCAAAACTTGCAATATAACATTCTATTGACTTTCTTAAAAATATTTTTTCTGTACCTAACTTGAGCATAAGGGTTATTTGAGCAAGTAACATTAACTCAGTGGAAGGCATTGTCCTGTGAAATATTCTTAGGCAGATCTGCCCACATCTTTATTGAA
Ensembl | human accession no.   ENSG00000020922
NCBI accession no.   NM_005591
shipped in   ambient
storage temp.   −20°C
Gene Information   human ... MRE11(4361), MRE11A(4361)

Description

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Biochem/physiol Actions

MRE11A (meiotic recombination 11 homolog A) is a nuclease which forms complex with Rad50 (DNA repair protein) and Nbs1 (nijmegen breakage syndrome protein 1). This complex works as a sensor of DNA double strand breaks, and is involved in DNA repair processes and DNA damage response. Absence of the complex activity causes developmental and/or degenerative neuronal disorders. In homologous recombination repair, MRE11A is responsible for the 3′-to-5′ exonuclease activity, leading to the generation of protruding 3′ ssDNA at double strand breaks. MRE11A is also an oncoprotein which is associated with colorectal cancer and malignant breast cancer. Hypomorphic mutations in this gene leads to Ataxia-Telangiectasia like disorder.

Legal Information

MISSION is a registered trademark of Sigma-Aldrich Co. LLC

Safety & Documentation

Safety Information

RIDADR 
NONH for all modes of transport
Flash Point(F) 
Not applicable
Flash Point(C) 
Not applicable
Protocols & Articles
Peer-Reviewed Papers
15

References

Related Products

Technical Service:

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Bulk Ordering & Pricing:

Need larger quantities for your development, manufacturing or research applications?