EMAIL THIS PAGE TO A FRIEND
EHU097551 Sigma-Aldrich

MISSION® esiRNA

targeting human TET3 (1)

  •  NACRES NA.51

Purchase

Properties

Related Categories Cancer Metabolism, Cancer Research, Cell Biology, Functional Genomics and RNAi, Gene Editing Tools For Studying the IDH Pathway,
Quality Level   100
description   Powered by Eupheria Biotech
product line   MISSION®
form   lyophilized powder
esiRNA cDNA target sequence   TCCTTTGGTTGTTCCTGGAGCATGTACTTCAACGGCTGCAAGTATGCTCGGAGCAAGACACCTCGCAAGTTCCGCCTCGCAGGGGACAATCCCAAAGAGGAAGAAGTGCTCCGGAAGAGTTTCCAGGACCTGGCCACCGAAGTCGCTCCCCTGTACAAGCGACTGGCCCCTCAGGCCTATCAGAACCAGGTGACCAACGAGGAAATAGCGATTGACTGCCGTCTGGGGCTGAAGGAAGGACGGCCCTTCGCGGGGGTCACGGCCTGCATGGACTTCTGTGCCCACGCCCACAAGGACCAGCATAACCTCTACAATGGGTGCACC
Ensembl | human accession no.   ENSG00000187605
shipped in   ambient
storage temp.   −20°C
Gene Information   human ... TET3(200424), TET3(200424)

Description

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Sigma-Aldrich Co. LLC

Safety & Documentation

Safety Information

RIDADR 
NONH for all modes of transport
Flash Point(F) 
Not applicable
Flash Point(C) 
Not applicable
Protocols & Articles

Articles

LCMS Separation and Identification of 2-Hydroxyglutarates

Sigma-Aldrich has recently developed an application for the separation and identification of S-2-hydroxyglutaric acids and R-2-hydroxyglutaric acids by chiral LC-MS, using a CHIROBIOTIC® R Column (co...
Keywords: AGE, Cancer, High performance liquid chromatography, Liquid chromatography mass spectrometry, Mass spectrometry, Metabolism, Reductions, Separation, Tools

Peer-Reviewed Papers
15

References

Related Products

Technical Service:

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Bulk Ordering & Pricing:

Need larger quantities for your development, manufacturing or research applications?