EMAIL THIS PAGE TO A FRIEND
EHU104061 Sigma-Aldrich

MISSION® esiRNA

esiRNA human AC103681.4 (esiRNA1)

  •  NACRES NA.51

Purchase

Properties

Related Categories AC09-AE0, Functional Genomics and RNAi, Human esiRNA, MISSION esiRNA Technology, Molecular Biology More...
Quality Level   100
description   Powered by Eupheria Biotech
product line   MISSION®
form   lyophilized powder
esiRNA cDNA target sequence   TTGGAGTGTGGGGAGAAAACTGGGTTCTTAGCATTAGAGAGGGAAGTGGCAGGTGGCAGATACAAGCTTAGCTCTGACCTGGGTGCACCTCAGCTCTGTGTCCTTTTTTTTCCCTGACCTGAAGCTGACCCCAGCAGAAGTCCCCCAGCCAACCCCTCCACCCAACAACCCCCCACCCTCCCATCCTGCCCCCAGCCATAGTGGGAGCTGGGAGGATTGCAGCATCTAGTGCCTTCCAAGGCTGTTCCTGGAGCGCTGCTTGTAAACCCAAGCCAAGCTTTGTCCCACGTAGGGAGAATGGAAGGTGACTGCAATGTCCCTGTGCCTTTGGCTCCATCTCCCCATTCTGTGGTTCTTTGGGGGTTCCTGCTTCCCTCAAACTGAACACTCTCCTGTCCAACAGCCTGATGGCTTAATTATTGCCTGGAATTGCCCGGCCTCCGATGCTGGAATCAAAGATTGCCTTCCGAAG
Ensembl | human accession no.   ENSG00000214934
shipped in   ambient
storage temp.   −20°C
Gene Information   human ... PRDM11(56981), AC103681.4(824)

Description

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Sigma-Aldrich Co. LLC

Safety & Documentation

Safety Information

RIDADR 
NONH for all modes of transport
Flash Point(F) 
Not applicable
Flash Point(C) 
Not applicable

Documents

Certificate of Analysis (COA)

Please Enter a Lot Number
Protocols & Articles
Related Products

Technical Service:

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Bulk Ordering & Pricing:

Need larger quantities for your development, manufacturing or research applications?