EMAIL THIS PAGE TO A FRIEND
EHU128121 Sigma-Aldrich

MISSION® esiRNA

targeting human GGT3P

  •  NACRES NA.51

Purchase

Properties

Related Categories Functional Genomics and RNAi, GB-GQ, Human esiRNA, MISSION esiRNA Technology, Molecular Biology More...
Quality Level   100
description   Powered by Eupheria Biotech
product line   MISSION®
form   lyophilized powder
esiRNA cDNA target sequence   AAAACAAGCGGACCGTCATCGAGCAGCAGCCTGTCTTGTGTGAGGTGTTCTGCCGGGATAGAAAGGTGCTTCGGGAGGGGGAGAGACTGACCCTGCCGCGGCTGGCTGACACCTACGAGATGCTGGCCATCGAGGGTGCCCAGGCCTTCTACAACGGCAGCCTCATGGCCCAGATTGTGAAGGACATCCAGGCGGCTGGGGGCATTGTGACAGCTGAGGACCTGAACAACTACTGTGCTGAGCTGATCGAGCACCCGCTGAACATCAGCCTGGGAGACGCGGTGCTGTACATGCCCAGTGCGCGGCTCAGCGGGCCCGTGCTGGCCCTCATCCTCAACATCCTCAAAGGGTACAACTTCTCCCGGGAGAGCGTGGAGACCCCCGAGCAGAAGGGCCTGACGTACCAC
Ensembl | human accession no.   ENSG00000197421
shipped in   ambient
storage temp.   −20°C
Gene Information   human ... GGT3P(2679)

Description

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Sigma-Aldrich Co. LLC

Safety & Documentation

Safety Information

Safety Information for this product is unavailable at this time.

Documents

Certificate of Analysis (COA)

Please Enter a Lot Number
Protocols & Articles
Related Products

Technical Service:

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Bulk Ordering & Pricing:

Need larger quantities for your development, manufacturing or research applications?