• USA Home
  • EMNC000721 - MISSION® esiRNA

EMAIL THIS PAGE TO A FRIEND
EMNC000721 Sigma-Aldrich

MISSION® esiRNA

targeting mouse Ak013935

  •  NACRES NA.51

Purchase

Properties

Related Categories 00-AK3700, Functional Genomics and RNAi, Long Non Coding esiRNA, Mouse, MISSION esiRNA Technology, Molecular Biology More...
product line   MISSION®
form   lyophilized powder
esiRNA cDNA target sequence   CTTCCATGTCAGGGCATCTTCTCTAACGCCCTGTCCCCACCTCGTCTCCCAATCTTCCACAGTTATGCAGCGCTCTTTGTGTGTGGGGAGAAAAATGTGATACACAGACACAAGGTGTGAACACTTGATGACTTGCCTGTCCCTGAGTTACTTGAATCGTGGGAATTGCTGAGAGGGTAATATTTAACAGCGATCCCCTCAGTCTCCGGAGGGAGTCCTTGCTTCAGTGATACAGAGCTTATACTGTATTGTGTATGCTAATGATGTCGGCTTGATTCTAGCATCTCCCTAAATTTTCCTCTTAAATGGCTTCTTTAGTGATTTAAGTTTGAGTTTGGGCCTTTGTC
GenBank® accession no.   AK013935
shipped in   ambient
storage temp.   −20°C
Gene Information   mouse ... Phactr4(100169)

Description

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

GenBank is a registered trademark of United States Department of Health and Human Services

MISSION is a registered trademark of Sigma-Aldrich Co. LLC

Safety & Documentation

Safety Information

RIDADR 
NONH for all modes of transport
Flash Point(F) 
Not applicable
Flash Point(C) 
Not applicable

Documents

Certificate of Analysis (COA)

Please Enter a Lot Number
Protocols & Articles
Related Products

Technical Service:

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Bulk Ordering & Pricing:

Need larger quantities for your development, manufacturing or research applications?