• USA Home
  • EMNC006541 - MISSION® Long Non-Coding esiRNA

EMAIL THIS PAGE TO A FRIEND
EMNC006541 Sigma-Aldrich

MISSION® Long Non-Coding esiRNA

AK003962 targeting mouse

Purchase

Properties

Related Categories 00-AK3700, Functional Genomics and RNAi, Long Non Coding esiRNA, Mouse, MISSION esiRNA Technology, Molecular Biology More...
product line   MISSION®
concentration   50 ng/μL RNA
esiRNA cDNA target sequence   CCGTGCCATTGAGATCTTTTATATTCATGCTGCTTCTAGTCCCTTCTCCACATCACCTAAGGGTGGGTACCTCCATTGCGATGTTGTGGCATCTTAACTTTTACACACAGACCTCATGGGTGTCCACTGAGGAAGTAGTATGAGCCTAAAGACACTGGCAGCGTGCAGCCTGGCCTGGGAGTGGCGGCCTTCGCATCTCTCTCTCTCTCAGCACTCAGCCA
GenBank® accession no.   AK003962
shipped in   dry ice
storage temp.   −20°C
Gene Information   mouse ... Eif2c2(239528)

Description

General description

MISSION esiRNA are endo-ribonuclease prepared siRNA. MISSION esiRNA are a heterogeneous mixture of siRNAs that all target the same mRNA sequence. These multiple silencing triggers lead to highly specific and effective gene silencing.
• esiRNAs have low-toxicity, low side-effects and high on-target efficacy
• esiRNAs are designed from cDNA thus only generating esiRNAs to authentic lncRNAs

Physical form

Solution in nuclease free TE buffer (10 mM Tris-HCl, pH 8.0, 1 mM EDTA)

Legal Information

GenBank is a registered trademark of United States Department of Health and Human Services

MISSION is a registered trademark of Sigma-Aldrich Co. LLC

Safety & Documentation

Safety Information

RIDADR 
NONH for all modes of transport

Documents

Certificate of Analysis

???PDP_SDS_LOT_NUMBER_ERROR_MSG???
Protocols & Articles
Related Products

Technical Service:

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Bulk Ordering & Pricing:

Need larger quantities for your development, manufacturing or research applications?