EMAIL THIS PAGE TO A FRIEND
EMU050191 Sigma-Aldrich

MISSION® esiRNA

esiRNA targeting mouse Mmp14 (esiRNA1)

  •  NACRES NA.51

Purchase

Properties

Related Categories Functional Genomics and RNAi, MD-MR, MISSION esiRNA Technology, Molecular Biology, Mouse esiRNA More...
Quality Level   100
description   Powered by Eupheria Biotech
product line   MISSION®
concentration   200 ng/μL RNA
esiRNA cDNA target sequence   GCTCCGAGGAGAGATGTTTGTCTTCAAGGAGCGATGGTTCTGGCGGGTGAGGAATAACCAAGTGATGGATGGATACCCAATGCCCATTGGCCAATTCTGGAGGGGCCTGCCTGCATCCATCAATACTGCCTACGAAAGGAAGGATGGCAAATTTGTCTTCTTCAAAGGAGATAAGCACTGGGTGTTTGACGAAGCCTCCCTGGAACCCGGGTACCCCAAGCACATTAAGGAGCTTGGCCGAGGGCTGCCCACGGACAAGATCGATGCAGCTCTCTTCTGGATGCCCAATGGGAAGACCTACTTCTTCCGGGGCAATAAGTACTACCGGTTCAATGAAGAATTCAGGGCAGTGGACAGCGAGTACCCTAAAAACATCAAAGTCTGGGAAGGAATCCCTGAATCTCCCAGGGGGTCATTCATGGGCAGTGATG
Ensembl | mouse accession no.   ENSMUSG00000000957
NCBI accession no.   NM_008608
shipped in   dry ice
storage temp.   −20°C
Gene Information   mouse ... Mmp14(17387)

Description

General description

MISSION esiRNA are endo-ribonuclease prepared siRNA. MISSION esiRNA are a heterogeneous mixture of siRNAs that all target the same mRNA sequence. These multiple silencing triggers lead to highly specific and effective gene silencing.

esiRNA Custom options:
ESISEC: Secondary independent esiRNA for any human or mouse esiRNA
ESIOPEN: Custom esiRNA targeting species specific sequence provided
Contact your local sales rep. or email us at Custom esiRNA for more information.

Physical form

Solution in low-TE (Tris-HCl (10 mM final), EDTA (1 mM final), pH to 8.0.

Other Notes

View the esiRNA screening tutorial

Legal Information

MISSION is a registered trademark of Sigma-Aldrich Co. LLC

Safety & Documentation

Safety Information

RIDADR 
NONH for all modes of transport
Flash Point(F) 
Not applicable
Flash Point(C) 
Not applicable

Documents

Certificate of Analysis (COA)

Please Enter a Lot Number
Protocols & Articles
Peer-Reviewed Papers
15

References

Related Products

Technical Service:

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Bulk Ordering & Pricing:

Need larger quantities for your development, manufacturing or research applications?