EMAIL THIS PAGE TO A FRIEND
EMU204631 Sigma-Aldrich

MISSION® esiRNA

targeting mouse Kdm3b

  •  NACRES NA.51

Purchase

Properties

Related Categories Functional Genomics and RNAi, KD-LP, MISSION esiRNA Technology, Molecular Biology, Mouse esiRNA More...
Quality Level   100
description   Powered by Eupheria Biotech
product line   MISSION®
form   lyophilized powder
esiRNA cDNA target sequence   GAAGCAGCACTCCTGGGTTAAGGTTCACGCTGAAGACGTGCTTGCGCTTCTGCTGGAAGGCTCACTTGTTTGGGCTCCCCGGAAGGACCCCGTCCTTCTGCAGGGCACCCGAGTCCCAGTTGCCCAGTGGCCAGCCCTGACTTTCACCCCCCTAGTAGATAAGCTGGGGTTGGGGTCTGTGGTGCCAGTTGAATACCTTGTGGATCGAGAGCTTCGTTTCCTGTCGGATGCTAATGGGATGCATCTGTTCCAGATGGGAACAGATGTTCAAAATCAGATTCTTTTAGAACATGCTGCATTAAGAGAGACAGTTAATGCTTTGATCAGTGACCAAAAGCTACAAGAGATTTTCAGCCGAGGTCCCTATAGTGTCCAGGGCCACAGAGTCAAGGTCTACCAACCCGAAGGAGAGGAAGTATGGCTCTGTGGTGTTGTGAGCCGTCAGGACTCAGTCACCCGTCTTATGGAAGTGTCTATAACTGAGACTGGTGAGGTCAAGTCAGTAGATCCCAGA
Ensembl | mouse accession no.   ENSMUSG00000038773
NCBI accession no.   NM_001081256
shipped in   ambient
storage temp.   −20°C
Gene Information   mouse ... KDM3B(277250), Kdm3b(277250)

Description

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Sigma-Aldrich Co. LLC

Safety & Documentation

Safety Information

RIDADR 
NONH for all modes of transport
Flash Point(F) 
Not applicable
Flash Point(C) 
Not applicable

Documents

Certificate of Analysis (COA)

Please Enter a Lot Number
Protocols & Articles
Related Products

Technical Service:

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Bulk Ordering & Pricing:

Need larger quantities for your development, manufacturing or research applications?