• USA Home
  • HUTR04785 - MISSION® 3′UTR Lenti GoClone

HUTR04785 Sigma-Aldrich

MISSION® 3′UTR Lenti GoClone

Powered by SwitchGear Genomics, 3′UTR, human, C1orf97

Synonym: HUTR

  •  NACRES NA.51



Related Categories BN-C11, Functional Genomics and RNAi, MISSION 3′UTR Lenti GoClone, powered by SwitchGear Genomics, Molecular Biology
Quality Level   200
description   Functional Validation of miRNA Gene Targets
product line   MISSION®
concentration   ≥1x105 VP/ml (via p24 assay)
human 3′UTR sequence   cagagtcttgtcctgttgctcaggctggagtgcaatgatgcgacctcggctcactgcaacctctgcctcccggattcaagcaattctcctgccacagcctcctaagtagctaggactacacgcatgcaccaccacacctggctaatttttgtatttttagtagggacggggtttcacctggttggccaggctggtctcgaactcctgacctcatgtgatccgtccacttcagcgtcccaaagtgctgggattaca (3′UTR sequences are truncated after the first 255 bases)
NCBI accession no.   NM_032705
shipped in   dry ice
storage temp.   −70°C
Gene Information   human ... C1orf97(84791)



To see more application data, protocols, and vector maps visit www.sigma.com/3utr.

Physical form

200 μL of at least 105 VP/mL (via p24 titering assay) lentiviral particles are provided as frozen stock.

Legal Information

Use of this product is subject to one or more license agreements. For details, please see www.sigmaaldrich.com/missionlicense.

GoClone is a trademark of SwitchGear Genomics

MISSION is a registered trademark of Sigma-Aldrich Co. LLC

SwitchGear Genomics is a trademark of SwitchGear Genomics

Safety & Documentation

Safety Information

UN 3245 9
WGK Germany 
Flash Point(F) 
Not applicable
Flash Point(C) 
Not applicable


Certificate of Analysis (COA)

Please Enter a Lot Number
Protocols & Articles


Genome-wide Collection of Lenti 3’UTR Reporters for Functional Validation of microRNA Targets

microRNAs (miRNAs) are a class of naturally occurring small non-coding RNA molecules that regulate a variety of developmental and physiological processes. To better understand miRNA-UTR interactions,...
Keywords: Genomics, Physiological Processes, Transfection

Related Products


Product #


Add to Cart

MLS0001 MISSION® LightSwitch Luciferase Assay Reagent, Fully optimized reporter system

Technical Service:

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Bulk Ordering & Pricing:

Need larger quantities for your development, manufacturing or research applications?