• USA Home
  • MIRAP00085 - MystiCq® microRNA qPCR Assay Primer

EMAIL THIS PAGE TO A FRIEND
MIRAP00085 Sigma

MystiCq® microRNA qPCR Assay Primer

hsa-miR-30c-2-3p

Purchase

Properties

Related Categories Molecular Biology, PCR/Amplification, Quantitative PCR, miRNA qPCR Assay Primers hsa-let-00 to hsa-miR-517, microRNA Quantitative PCR More...
form   liquid
concentration   10 mg/mL
mature sequence   CUGGGAGAAGGCUGUUUACUCU
mp   ~76 °C
Sanger mature/minor accession no.   MIMAT0004550
shipped in   wet ice
storage temp.   −20°C
Gene Information   human ... MIR30C2(407032)

Description

Other Notes

Formerly hsa-miR-30c-2*. Compatible with mmu-miR-30c-2* and rno-miR-30c-2*.

Features and Benefits

Features and Benefits
• Proprietary design features of assay primers allow for specificity towards mature microRNAs vs. precursor-microRNAs
• Extensive design and testing of oligo-dT adapter primer to incorporate complementary Universal PCR Primer sequence
• No self-complementarity or primer dimer artifacts with the Universal PCR Primer
• Optimized primer Tm designed to match the Universal PCR Primer
• Universal cycling conditions ensures robust amplification for all assays in profiling experiments
• Optimized PCR product Tm (75-78° C)

General description

The MystiCq microRNA qPCR Assay Primer is an integral part of the MystiCq microRNA qPCR Assay System. It has been designed to target specific microRNAs with the MystiCq Universal PCR primer and the MystiCq microRNA SYBR Green qPCR ReadyMix on cDNA templates generated by the MystiCq microRNA cDNA Synthesis Mix kit.

Legal Information

MystiCq is a registered trademark used under license.

Price and Availability


PCR Selection Tool

All labs need water
Safety & Documentation

Safety Information

RIDADR 
NONH for all modes of transport
WGK Germany 
1

Documents

Certificate of Analysis

Protocols & Articles

Related Content

PCR Selection Guide

Sigma-Aldrich offers a wide variety of PCR reagents to meet any experimental needs. Our range of polymerases is customized to meet your End-Point PCR, qPCR, or RT-PCR needs. Our products vary from ro...
Keywords: Polymerase chain reaction, Polymerase chain reaction - quantitative

Related Products

related product

Product #

Description

Add to Cart

MIRRM03 MystiCq® microRNA® SYBR® Green qPCR ReadyMix, Formulation for miRNA RT-qPCR on iQ Bio-Rad platforms
MIRRM00 MystiCq® microRNA® SYBR® Green qPCR ReadyMix, Formulated for systems that do not require normalization
MIRRM02 MystiCq® microRNA® SYBR® Green qPCR ReadyMix, with ROX, formulation for miRNA RT-qPCR
MIRRM01 MystiCq® microRNA® SYBR® Green qPCR ReadyMix, Low ROX formulation for miRNA RT-qPCR
MIRUP MystiCq® Universal PCR Primer
MIRRT MystiCq® microRNA cDNA Synthesis Mix

Technical Service:

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Bulk Ordering & Pricing:

Need larger quantities for your development, manufacturing or research applications?