• USA Home
  • MIRAP01433 - MystiCq® microRNA qPCR Assay Primer

EMAIL THIS PAGE TO A FRIEND
MIRAP01433 Sigma-Aldrich

MystiCq® microRNA qPCR Assay Primer

rno-miR-1

Purchase

Properties

Related Categories Molecular Biology, PCR/Amplification, Quantitative PCR, miRNA qPCR Assay Primers hsa-miR-3661 to rno-miR-1, microRNA Quantitative PCR More...
form   liquid
concentration   10 mg/mL
mature sequence   UGGAAUGUAAAGAAGUGUGUAU
mp   ~75.5 °C
Sanger mature/minor accession no.   MIMAT0003125
shipped in   wet ice
storage temp.   −20°C
Gene Information   rat ... MIR1(100314077)

Description

General description

The MystiCq microRNA qPCR Assay Primer is an integral part of the MystiCq microRNA qPCR Assay System. It has been designed to target specific microRNAs with the MystiCq Universal PCR primer and the MystiCq microRNA SYBR Green qPCR ReadyMix on cDNA templates generated by the MystiCq microRNA cDNA Synthesis Mix kit.

Features and Benefits

Features and Benefits
• Proprietary design features of assay primers allow for specificity towards mature microRNAs vs. precursor-microRNAs
• Extensive design and testing of oligo-dT adapter primer to incorporate complementary Universal PCR Primer sequence
• No self-complementarity or primer dimer artifacts with the Universal PCR Primer
• Optimized primer Tm designed to match the Universal PCR Primer
• Universal cycling conditions ensures robust amplification for all assays in profiling experiments
• Optimized PCR product Tm (75-78° C)

Legal Information

MystiCq is a registered trademark of Qiagen Beverly Inc.

Safety & Documentation

Safety Information

RIDADR 
NONH for all modes of transport
WGK Germany 
WGK 1
Flash Point(F) 
Not applicable
Flash Point(C) 
Not applicable

Documents

Certificate of Analysis (COA)

Please Enter a Lot Number
Protocols & Articles

Protocols

MystiCq® MicroRNA® Quantitation System

Technology Overview Workflow Background Protocols miRNA isolation cDNA synthesis miRNA qPCR Advanced information Product selection guides Troubleshooting
Keywords: AGE, Amplification, Buffers, Cell disruption, Centrifugation, Degradations, Diagnostic, Digestions, Diseases, Electrophoresis, Gel electrophoresis, Gene expression, Homogenization, Microarray Analysis, Molecular biology, Nucleic acid annealing, Nucleic acid denaturation, PAGE, Polymerase chain reaction, Polymerase chain reaction - quantitative, Precipitation, Purification, RNA purification, Sample preparations, Separation, Solvents, Titrations

Related Content

PCR Selection Guide

We offer a wide variety of PCR enzymes, master mixes, and PCR protocols to meet your experimental needs for routine PCR, qPCR, or RT-PCR. Our PCR Selection Guide features various filters to sort by, ...
Keywords: Genomics, Polymerase chain reaction, Polymerase chain reaction - quantitative

Peer-Reviewed Papers
15

References

Related Products

related product

Product #

Description

Add to Cart

MIRRM03 MystiCq® microRNA® SYBR® Green qPCR ReadyMix, Formulation for miRNA RT-qPCR on iQ Bio-Rad platforms
MIRRM00 MystiCq® microRNA® SYBR® Green qPCR ReadyMix, Formulated for systems that do not require normalization
MIRRM02 MystiCq® microRNA® SYBR® Green qPCR ReadyMix, with ROX, formulation for miRNA RT-qPCR
MIRRM01 MystiCq® microRNA® SYBR® Green qPCR ReadyMix, Low ROX formulation for miRNA RT-qPCR
MIRUP MystiCq® Universal PCR Primer
MIRRT MystiCq® microRNA cDNA Synthesis Mix

Technical Service:

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Bulk Ordering & Pricing:

Need larger quantities for your development, manufacturing or research applications?