• USA Home
  • MLTUD1131 - MISSION® Lenti microRNA Inhibitor, Mouse

EMAIL THIS PAGE TO A FRIEND
MLTUD1131 Sigma-Aldrich

MISSION® Lenti microRNA Inhibitor, Mouse

mmu-miR-344f-5p

Synonym: Tough Decoy, TuD

  •  NACRES NA.51

Purchase

Properties

Related Categories Functional Genomics and RNAi, MISSION Lenti microRNA Inhibitors, Molecular Biology, Mouse Lenti microRNA Inhibitors, mmu-miR-341 to mmu-miR-670 More...
Quality Level   200
product line   MISSION®
concentration   ≥1x106 VP/ml (via p24 assay)
mature sequence   AGUCAGUCUCCUGGCUGGAGUC
Sanger mature/minor accession no.   MIMAT0014931
Sanger microRNA accession no.   MI0014098
shipped in   dry ice
storage temp.   −70°C

Description

General description

Individual lenti microRNA inhibitors are designed using a proprietary algorithm, which is based on the work of Haraguchi, T, et al. and in collaboration with Dr. Hideo Iba, University of Tokyo. This algorithm utilizes the tough decoy (TuD) design. miRNA are known to regulate gene expression in a variety of manners, including translational repression, mRNA cleavage and deadenylation. The lentiviral microRNA Inhibitors are cloned into the TRC2-pLKO-puro vector. Co-transfection of this vector into the appropriate cell line with compatible packaging plasmids produces viral particles that can be used to transduce mammalian cells. Additionally, the Woodchuck Hepatitis Post-Transcriptional Regulatory Element2 (WPRE) is included, allowing for enhanced expression of transgenes delivered by lentiviral vectors. This lentiviral vector also carries a puromycin resistance gene for selection of cells.

Allows for potent inhibition of the desired miRNA
Lentiviral delivery format allows for efficient delivery of the inhibitor into a wide variety of cell types
Enables long-term inhibition without repeat transfection

Other Notes

Based on miRBase V19 Mature ID

Legal Information

MISSION is a registered trademark of Sigma-Aldrich Co. LLC

Safety & Documentation

Safety Information

RIDADR 
UN 3245 9
WGK Germany 
WGK 3
Flash Point(F) 
Not applicable
Flash Point(C) 
Not applicable

Documents

Certificate of Analysis (COA)

Please Enter a Lot Number
Protocols & Articles
Related Products

Technical Service:

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Bulk Ordering & Pricing:

Need larger quantities for your development, manufacturing or research applications?