
Certain features of will be down for maintenance Saturday afternoon/evening, February 24th starting at 3:00 pm CT until 9:00 pm CT.

Please note that you still have telephone and email access to our local offices. We apologize for any inconvenience.


Imprint® Ultra Chromatin Immunoprecipitation Kit

One of the Industry's Leading Kits Optimized for Sensitivity, Binding Capacity and Next-Gen Sequencing

Sigma’s second generation chromatin immunoprecipitation (ChIP) kit was developed for maximum sensitivity and optimum next-generation sequencing results. The DNA-blocked “Staph-Seq” cells are ideally suited for studying recruitment of low abundance transcription factors (TF) in genome wide location analysis experiments such as ChIP-chip and ChIP-Seq. The Imprint ChIP Kit provides a complete solution for Chromatin Immunoprecipitation including columns and reagents for DNA purification. The kit allows researchers to explore the genome-wide binding sites of low abundance TF’s as well as novel histone modifications. The flexible format allows for immunoprecipitation and purification of DNA from mammalian cells or tissue.

  • Greater capacity can be used over a wide range of cell numbers ranging from 2 x 106 – 10 x 106
  • Successful chromatin immunoprecipitation of DNA associated with low abundance, medium and highly expressed transcription factors as well as histone modifications
  • Most sensitive kit capable of detecting genome-wide binding sites of low abundance transcription factors in ChIP-seq
  • Employs DNA-Blocked “Staph-Seq” for IP (immunoprecipitation) minimizing contaminating Staph A DNA in downstream ChIP-Seq applications (included in the kit). Now also available for sale separately.

View the poster "Imprint Ultra Chromatin IP Kit: for Successful ChIP-Seq with a Low Abundance Transcription Factor" (579 Kb PDF)

Figure 1. ChIPs were performed with 2 μL of EZH2 Ab (Diagenode, pAb39) and 1 μL of Rabbit IgG (Product No. I5006) with chromatin from DU145 cells as indicated (10 million cells on left panel and 2 million on right panel). 2 μL ChIP’ed DNA (out of 30 μL eluate) was analyzed by qPCR using primers for the sonic hedgehog (SHH) gene promoter, a target for EZH2- containing polycomb repression complex, and a non-target ZNF333 gene (ZNF333-3’).

Figure 2. ChIPs were performed with 2 μL of H3K27me3 Ab (Diagenode, pAb069) and 1 μL of Rabbit IgG (Product No. I5006) with chromatin from DU145 cells as indicated (10 million cells on left panel and 2 million on right panel). 2 μL ChIP’ed DNA (out of 30 μL eluate) was analyzed by qPCR using primers for the sonic hedgehog (SHH) gene promoter, and a non-target ZNF333 gene (ZNF333-3’).

"Staph A"
Total Reads 45,368,364 34,942,887
Mapped Reads (HG19) 29,878,289
(65.9 %)
(88.9 %)
Unique 17,171,199 22,200,188

Table 1. Summary of ChIP-Seq results for EZH2, a low abundant target, performed with Imprint Ultra ChIP kit (CHP2). The results above show a dramatic improvement of the number of sequence reads (23% gain) that map back to the genome of interest in BLASTsearch against the human reference genome.

Figure 3. Sigma’s kit was compared for sensitivity with kits from four other vendors using a low expression transcription factor EZH2. ChIPs were performed with 2 μL of EZH2 Ab (Diagenode, pAb39) and 1 μL of Rabbit IgG (Product No. I5006) with chromatin from 2 million DU145 cells. 2 μL ChIP’ed DNA (out of 30 μL eluate) was analyzed by qPCR using primers for the sonic hedgehog (SHH) gene promoter, and a non-target ZNF333 gene (ZNF333-3’) Sigma’s ChIP kit was the only product that gave unequivocal results, with 45 fold enrichment of target (SHH) and negligible enrichment of non-target (ZNF). Competitors lacked sensitivity and specificity (non-target enrichment to >50% of non-target.

ChIP-qPCR Data Analysis for % Input and Fold Enrichment Calculations (27 Kb Excel File)

Mouse and Rat Primer Sequences

Mouse primers for validating RNAP II ChIPs

Primer Sequence Genomic position (July 2007, mm9) Amplicon size (bp)
Positive Control m-Actin FP 5' AGCAATAGCCGGAAAGCCAGATCC 3' chr5:143668924-143669097 174
Negative Control* m-Fscn2 FP 5’ CATCCAGGAGCCACTGAAAT 3’ chr11:120222708-120222891 184

*Barrera, L. et al. 2008. Genome-wide mapping and analysis of active promoters in mouse enbryonic stem cells and adult organs. Genome Res. 18: 46-59. doi:10.1101/gr.6654808

Fold Enrichment of RNAP II on Mouse Actin

Figure 4. RNAP II ChIP with Mouse Chromatin:
ChIPs were performed with 2.5 mL of RNAP II Ab (Product No. WH0005430M1) and 0.5 mL of Mouse IgG (Product No. I5381) with 250 mL chromatin from NIH 3T3 cells (Active Motif 53021). 2 mL ChIP'ed DNA (out of 30 mL eluate) was analyzed by q-PCR using primers for the Mouse Actin gene promoter, a housekeeping gene and a non-target Fscn2 gene promoter.

Rat primer for validating RNAP II ChIPs

Primer Sequence Genomic position (Rat Nov. 2004) Amplicon size (bp)
Positive Control r-Actin FP 5' CAGAGAGTCACTCCCCCTTGC 3' chr12:12046379-12046575 197

Ordering Information

Product Name Product No.
Imprint Ultra Chromatin Immunoprecipitation Kit
Imprint Ultra Chromatin Immunoprecipitation Kit without controls
Imprint Ultra Chromatin Optimizing Kit CHROP-15RXN
Staph-Seq for Chromatin Immunoprecipitation S6576

Imprint® ChIP Validated Antibodies

Successful chromatin immunoprecipitation requires an effective, specific, and high quality antibody. Not all antibodies work in ChIP as the antigen epitope may be blocked or altered once cross-linked. Sigma’s Imprint brand of antibodies are validated in ChIP application and lot tested each time for successful chromatin immunoprecipitation experiment. For a complete list of ChIP validated antibodies please click here.

back to top