Attention:

Certain features of sigmaaldrich.com will be down for maintenance Saturday afternoon/evening, February 24th starting at 3:00 pm CT until 9:00 pm CT.

Please note that you still have telephone and email access to our local offices. We apologize for any inconvenience.

TargeTron Resources

pACD4K-C Vector Sequence

pACD4K-C Vector Sequence (7,678 bp) Substitute your TargeTron oligo sequences to replace the N’s at the following positions. 
IBS: 1792-1844 (53 bp) EBS2: 2024-2072 (49 bp) EBS1d: 2085-2144 (60 bp) GAATTCCGGATGAGCATTCATCAGGCGGGCAAGAATGTGAATAAAGGCCGGATAAAACTTGTGCTTATTTTTCTTTACGGTCTTTAA
AAAGGCCGTAATATCCAGCTGAACGGTCTGGTTATAGGTACATTGAGCAACTGACTGAAATGCCTCAAAATGTTCTTTACGATGCCA
TTGGGATATATCAACGGTGGTATATCCAGTGATTTTTTTCTCCATTTTAGCTTCCTTAGCTCCTGAAAATCTCGATAACTCAAAAAATA
CGCCCGGTAGTGATCTTATTTCATTATGGTGAAAGTTGGAACCTCTTACGTGCCGATCAACGTCTCATTTTCGCCAAAAGTTGGCCCA
GGGCTTCCCGGTATCAACAGGGACACCAGGATTTATTTATTCTGCGAAGTGATCTTCCGTCACAGGTATTTATTCGGCGCAAAGTGC
GTCGGGTGATGCTGCCAACTTACTGATTTAGTGTATGATGGTGTTTTTGAGGTGCTCCAGTGGCTTCTGTTTCTATCAGCTGTCCCT
CCTGTTCAGCTACTGACGGGGTGGTGCGTAACGGCAAAAGCACCGCCGGACATCAGCGCTAGCGGAGTGTATACTGGCTTACTAT
GTTGGCACTGATGAGGGTGTCAGTGAAGTGCTTCATGTGGCAGGAGAAAAAAGGCTGCACCGGTGCGTCAGCAGAATATGTGAT
ACAGGATATATTCCGCTTCCTCGCTCACTGACTCGCTACGCTCGGTCGTTCGACTGCGGCGAGCGGAAATGGCTTACGAACGGGG
CGGAGATTTCCTGGAAGATGCCAGGAAGATACTTAACAGGGAAGTGAGAGGGCCGCGGCAAAGCCGTTTTTCCATAGGCTCCGC
CCCCCTGACAAGCATCACGAAATCTGACGCTCAAATCAGTGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCC
CTGGCGGCTCCCTCGTGCGCTCTCCTGTTCCTGCCTTTCGGTTTACCGGTGTCATTCCGCTGTTATGGCCGCGTTTGTCTCATTCCA
CGCCTGACACTCAGTTCCGGGTAGGCAGTTCGCTCCAAGCTGGACTGTATGCACGAACCCCCCGTTCAGTCCGACCGCTGCGCCT
TATCCGGTAACTATCGTCTTGAGTCCAACCCGGAAAGACATGCAAAAGCACCACTGGCAGCAGCCACTGGTAATTGATTTAGAGG
AGTTAGTCTTGAAGTCATGCGCCGGTTAAGGCTAAACTGAAAGGACAAGTTTTGGTGACTGCGCTCCTCCAAGCCAGTTACCTCGG
TTCAAAGAGTTGGTAGCTCAGAGAACCTTCGAAAAACCGCCCTGCAAGGCGGTTTTTTCGTTTTCAGAGCAAGAGATTACGCGCA
GACCAAAACGATCTCAAGAAGATCATCTTATTAATCAGATAAAATATTTCTAGCTAGATTTCAGTGCAATTTATCTCTTCAAATGTA
GCACCTGAAGTCAGCCCCATACGATATAAGTTGTAATTCTCATGTTTGACAGCTTATCATCGATAAGCTCAAGGAGATGGCGCCC
AACAGTCCCCCGGCCACGGGGCCTGCCACCATACCCACGCCGAAACAAGCGCTCATGAGCCCGAAGTGGCGAGCCCGATCTTC
CCCATCGGTGATGTCGGCGATATAGGCGCCAGCAACCGCACCTGTGGCGCCGGTGATGCCGGCCACGATGCGTCCGGCGTAGA
GGATCGAGATCTCGATCCCGCGAAATTAATACGACTCACTATAGGGGAATTGTGAGCGGATAACAATTCCCCTCTAGNNNNAAG
CTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTAAGTCAAGTAGTTTAAGGTACTACTCTGTAAGAT
AACACAGAAAACAGCCAACCTAACCGAAAAGCGAAAGCTGATACGGGAACAGAGCACGGTTGGAAAGCGATGAGTTACCTAAAG
ACAATCGGGTACGACTGAGTCGCAATGTTAATCAGATATAAGGTATAAGTTGTGTTTACNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNGAAACCTCTAGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNTGTACANNNNNTAGGAGAACCTATGGGAACGAAACGAAAGCGATGCCGAGAATCTGAATTTACCAAGACTTAACACTAA
CTGGGGATACCCTAAACAAGAATGCCTAATAGAAAGGAGGAAAAAGGCTATAGCACTAGAGCTTGAAAATCTTGCAAGGGTACGG
AGTACTCGTAGTAGTCTGAGAAGGGTAACGCCCTTTACATGGCAAAGGGGTACAGTTATTGTGTACTAAAATTAAAAATTGATTAG
GGAGGAAAACCTCAAAATGAAACCAACAATGGCAATTTTAGAAAGAATCAGTAAAAATTCACAAGAAAATATAGACGAAGTTTTTA
CAAGACTTTATCGTTATCTTTTACGTCCAGATATTTATTACGTGGCGACGCGTACTAAAACAATTCATCCAGTAAAATATAATATTTT
ATTTTCTCCCAATCAGGCTTGATCCCCAGTAAGTCAAAAAATAGCTCGACATACTGTTCTTCCCCGATATCCTCCCTGATCGACCGG
ACGCAGAAGGCAATGTCATACCACTTGTCCGCCCTGCCGCTTCTCCCAAGATCAATAAAGCCACTTACTTTGCCATCTTTCACAAA
GATGTTGCTGTCTCCCAGGTCGCCGTGGGAAAAGACAAGTTCCTCTTCGGGCTTTTCCGTCTTTAAAAAATCATACAGCTCTCTTG
GGTTAATTGAGGCCTGAGTATAAGGTGACTTATACTTGTAATCTATCTAAACGGGGAACCTCTCTAGTAGACAATCCCGTGCTAAA
TTGTAGGACTGCCCTTTAATAAATACTTCTATATTTAAAGAGGTATTTATGAAAAGCGGAATTTATCAGATTAAAAATACTTTCTCTA
GAGAAAATTTCGTCTGGATTAGTTACTTATCGTGTAAAATCTGATAAATGGAATTGGTTCTACATAAATGCCTAACGACTATCCCTT
TGGGGAGTAGGGTCAAGTGACTCGAAACGATAGACAACTTGCTTTAACAAGTTGGAGATATAGTCTGCTCTGCATGGTGACATGC
AGCTGGATATAATTCCGGGGTAAGATTAACGACCTTATCTGAACATAATGCTTTAAATGGAGTGTCTTCTTCCCAGTTTTCGCAATC
CACATCGGCCAGATCGTTATTCAGTAAGTAATCCAATTCGGCTAAGCGGCTGTCTAAGCTATTCGTATAGGGACAATCCGATATGT
CGATGGAGTGAAAGAGCCTGATGCACTCCGCATACAGCTCGATAATCTTTTCAGGGCTTTGTTCATCTTCATACTCTTCCGAGCAA
AGGACGCCATCGGCCTCACTCATGAGCAGATTGCTCCAGCCATCATGCCGTTCAAAGTGCAGGACCTTTGGAACAGGCAGCTTTC
CTTCCAGCCATAGCATCATGTCCTTTTCCCGTTCCACATCATAGGTGGTCCCTTTATACCGGCTGTCCGTCATTTTTAAATATAGGT
TTTCATTTTCTCCCACCAGCTTATATACCTTAGCAGGAGACATTCCTTCCGTATCTTTTACGCAGCGGTATTTTTCGATCAGTTTTTT
CAATTCCGGTGATATTCTCATTTTAGCCATTTATTATTTCCTTCCTCTTTTCTACAGTATTTAAAGATACCCCAAGAAGCTAATTATAA
CAAGACGAACTCCAATTCACTGTTCCTTGCATTCTAAAACCTTAAATACCAGAAAACAGCTTTTTCAAAGTTGTTTTCAAAGTTGGC
GTATAACATAGTATCGACGGAGCCGATTTTGAAACGCGTTGGGAAATGGCAATGATAGCGAAACAACGTAAAACTCTTGTTGTATG
CTTTCATTGTCATCGTCACGTGATTCATAAACACAAGTGAATGTCGACAGTGAATTTTTACGAACGAACAATAACAGAGCCGTATA
CTCCGAGAGGGGTACGTACGGTTCCCGAAGAGGGTGGTGCAAACCAGTCACAGTAATGTGAACAAGGCGGTACCTCCCTACTTC
ACCATATCATTTTCTGCAGCCCCCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGATATACATATATGGCTAGATCGTCCATTCCG
ACAGCATCGCCAGTCACTATGGCGTGCTGCTAGCGCTATATGCGTTGATGCAATTTCTATGCACTCGTAGTAGTCTGAGAAGGGTA
ACGCCCTTTACATGGCAAAGGGGTACAGTTATTGTGTACTAAAATTAAAAATTGATTAGGGAGGAAAACCTCAAAATGAAACCAAC
AATGGCAATTTTAGAAAGAATCAGTAAAAATTCACAAGAAAATATAGACGAAGTTTTTACAAGACTTTATCGTTATCTTTTACGTCC
AGATATTTATTACGTGGCGTATCAAAATTTATATTCCAATAAAGGAGCTTCCACAAAAGGAATATTAGATGATACAGCGGATGGCT
TTAGTGAAGAAAAAATAAAAAAGATTATTCAATCTTTAAAAGACGGAACTTACTATCCTCAACCTGTACGAAGAATGTATATTGCAA
AAAAGAATTCTAAAAAGATGAGACCTTTAGGAATTCCAACTTTCACAGATAAATTGATCCAAGAAGCTGTGAGAATAATTCTTGAA
TCTATCTATGAACCGGTATTCGAAGATGTGTCTCACGGTTTTAGACCTCAACGAAGCTGTCACACAGCTTTGAAAACAATCAAAAG
AGAGTTTGGCGGCGCAAGATGGTTTGTGGAGGGAGATATAAAAGGCTGCTTCGATAATATAGACCACGTTACACTCATTGGACTC
ATCAATCTTAAAATCAAAGATATGAAAATGAGCCAATTGATTTATAAATTTCTAAAAGCAGGTTATCTGGAAAACTGGCAGTATCAC
AAAACTTACAGCGGAACACCTCAAGGTGGAATTCTATCTCCTCTTTTGGCCAACATCTATCTTCATGAATTGGATAAGTTTGTTTTA
CAACTCAAAATGAAGTTTGACCGAGAAAGTCCAGAAAGAATAACACCTGAATATCGGGAGCTCCACAATGAGATAAAAAGAATTT
CTCACCGTCTCAAGAAGTTGGAGGGTGAAGAAAAAGCTAAAGTTCTTTTAGAATATCAAGAAAAACGTAAAAGATTACCCACACTC
CCCTGTACCTCACAGACAAATAAAGTATTGAAATACGTCCGGTATGCGGACGACTTCATTATCTCTGTTAAAGGAAGCAAAGAGGA
CTGTCAATGGATAAAAGAACAATTAAAACTTTTTATTCATAACAAGCTAAAAATGGAATTGAGTGAAGAAAAAACACTCATCACAC
ATAGCAGTCAACCCGCTCGTTTTCTGGGATATGATATACGAGTAAGGAGATCTGGAACGATAAAACGATCTGGTAAAGTCAAAAA
GAGAACACTCAATGGGAGTGTAGAACTCCTTATTCCTCTTCAAGACAAAATTCGTCAATTTATTTTTGACAAGAAAATAGCTATCCA
AAAGAAAGATAGCTCATGGTTTCCAGTTCACAGGAAATATCTTATTCGTTCAACAGACTTAGAAATCATCACAATTTATAATTCTGA
ACTCCGCGGGATTTGTAATTACTACGGTCTAGCAAGTAATTTTAACCAGCTCAATTATTTTGCTTATCTTATGGAATACAGCTGTCT
AAAAACGATAGCCTCCAAACATAAGGGAACACTTTCAAAAACCATTTCCATGTTTAAAGATGGAAGTGGTTCGTGGGGGATCCCG
TATGAGATAAAGCAAGGTAAGCAGCGCCGTTATTTTGCAAATTTTAGTGAATGTAAATCCCCTTATCAATTTACGGATGAGATAAG
TCAAGCTCCTGTATTGTATGGCTATGCCCGGAATACTCTTGAAAACAGGTTAAAAGCTAAATGTTGTGAATTATGTGGGACGTCTG
ATGAAAATACTTCCTATGAAATTCACCATGTCAATAAGGTCAAAAATCTTAAAGGCAAAGAAAAATGGGAAATGGCAATGATAGCG
AAACAACGTAAAACTCTTGTTGTATGCTTTCATTGTCATCGTCACGTGATTCATAAACACAAGTGAATGTCGAGCACCCGTTCTCGG
AGCACTGTCCGACCGCTTTGGCCGCCGCCCAGTCCTGCTCGCTTCGCTACTTGGAGCCACTATCGACTACGCGATCATGGCGACC
ACACCCGTCCTGTGGATCGCCAAGCTCGCCGATGGTAGTGTGGGGTCTCCCCATGCGAGAGTAGGGAACTGCCAGGCATCAAAT
AAAACGAAAGGCTCAGTCGAAAGACTGGGCCTTTCGTTTTATCTGTTGTTTGTCGGTGAACGCTCTCCTGAGTAGGACAAATCCGC
CGGGAGCGGATTTGAACGTTGCGAAGCAACGGCCCGGAGGGTGGCGGGCAGGACGCCCGCCATAAACTGCCAGGCATCAAATT
AAGCAGAAGGCCATCCTGACGGATGGCCTTTTTGCGTTTCTACAAACTCTTCCTGTCGTCATATCTACAAGCCATCCCCCCACAGA
TACGGTAAACTAGCCTCGTTTTTGCATCAGGAAAGCAGAACGCCATGAGCGGCCTCATTTCTTATTCTGAGTTACAACAGTCCGCA
CCGCTGTCCGGTAGCTCCTTCCGGTGGGCGCGGGGCATGACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGT
AGGACAGGTGCCGGCAGCGCCCAACAGTCCCCCGGCCACGGGGCCTGCCACCATACCCACGCCGAAACAAGCGCCCTGCACCA
TTATGTTCCGGATCTGCATCGCAGGATGCTGCTGGCTACCCTGTGGAACACCTACATCTGTATTAACGAAGCGCTAACCGTTTTTA
TCAGGCTCTGGGAGGCAGAATAAATGATCATATCGTCAATTATTACCTCCACGGGGAGAGCCTGAGCAAACTGGCCTCAGGCATT
TGAGAAGCACACGGTCACACTGCTTCCGGTAGTCAATAAACCGGTAAACCAGCAATAGACATAAGCGGCTATTTAACGACCCTGC
CCTGAACCGACGACCGGGTCGAATTTGCTTTCGAATTTCTGCCATTCATCCGCTTATTATCACTTATTCAGGCGTAGCACCAGGCG
TTTAAGGGCACCAATAACTGCCTTAAAAAAATTACGCCCCGCCCTGCCACTCATCGCAGTACTGTTGTAATTCATTAAGCATTCTG
CCGACATGGAAGCCATCACAGACGGCATGATGAACCTGAATCGCCAGCGGCATCAGCACCTTGTCGCCTTGCGTATAATATTTGC
CCATGGTGAAAACGGGGGCGAAGAAGTTGTCCATATTGGCCACGTTTAAATCAAAACTGGTGAAACTCACCCAGGGATTGGCTGA
GACGAAAAACATATTCTCAATAAACCCTTTAGGGAAATAGGCCAGGTTTTCACCGTAACACGCCACATCTTGCGAATATATGTGTA
GAAACTGCCGGAAATCGTCGTGGTATTCACTCCAGAGCGATGAAAACGTTTCAGTTTGCTCATGGAAAACGGTGTAACAAGGGTG
AACACTATCCCATATCACCAGCTCACCGTCTTTCATTGCCATACG