[Skip to Content](https://www.sigmaaldrich.com#main-content) [![MilliporeSigma](https://www.sigmaaldrich.com/static/logos/purple/millipore_sigma.svg)](https://www.sigmaaldrich.com/US/en) Products Cart0 USEN Products ProductsApplicationsServicesResourcesSupport [Login / Register](https://www.sigmaaldrich.com/oidc-sign-in) [Order Lookup](https://www.sigmaaldrich.com/US/en/order-lookup) [Quick Order](https://www.sigmaaldrich.com/US/en/quick-order) Cart0 [Home](https://www.sigmaaldrich.com/US/en)[Polymerase Chain Reaction Applications](https://www.sigmaaldrich.com/US/en/applications/genomics/pcr)Custom LAMP Primers in Partnership with New England Biolabs # Custom LAMP Primers in Partnership with New England Biolabs ![New England BioLabs Logo](https://www.sigmaaldrich.com/content/dam/cms-commons/sigmaaldrich/marketing/global/images/technical-documents/articles/genomics/pcr/ne-bio-labs-logo.png "New England Biolabs") [NEB LAMP Primer Design Tool](https://lamp.neb.com/#!/) [Request Quote](https://www.sigmaaldrich.com/US/en/campaigns/custom-lamp-primers-request) * * * - [Lamp Primer Design](https://www.sigmaaldrich.com#primer-design) - [Quality Assurance](https://www.sigmaaldrich.com#quality-assurance) - [SARS-CoV-2 Targets](https://www.sigmaaldrich.com#sars-targets) - [References](https://www.sigmaaldrich.com#references) Combined with real time detection, LAMP (loop-mediated isothermal amplification) has been a popular isothermal amplification technology used to create COVID-19 [molecular diagnostics](https://www.360dx.com/coronavirus-test-tracker-launched-covid-19-tests). Among other reasons, this is likely because LAMP, specifically RT-LAMP (reverse transcription LAMP) in the case of SARS-CoV-2, is a robust method for specific detection of nucleic acids. Though these methods are robust, it is still best to optimize the reaction as well as its components. This is especially true considering LAMP is well-recognized for producing spurious amplicons that can lead to false positive results1. While it is up to the assay developer to optimize the reaction, vendors must lead the way optimizing the components. The strand displacing polymerase, e.g. *Bst* DNA Polymerase, which catalyzes the LAMP reaction, is an important component that has properties subject to direct improvement, e.g. via site-directed mutagenesis2. A quick and indirect way of “improving the polymerase” is by enhancing another equally-important component, the primers. The best way of doing this is by fine-tuning the purification methods used in the manufacturing process (Figure 1). Either Desalt or HPLC purification of LAMP oligonucleotides is common, and it is often possible to modify both methods to create optimized primers. Custom LAMP Primers, a derivative of our [iScale Oligos™](https://www.sigmaaldrich.com/US/en/technical-documents/technical-article/genomics/pcr/custom-iscale-oligos), are intended to maximize the function of LAMP primers in assays to be used as life science research tools, molecular diagnostics, and laboratory developed tests. ![Graphical representation of the Primer purification process](https://www.sigmaaldrich.com/content/dam/cms-commons/sigmaaldrich/marketing/global/images/technical-documents/articles/genomics/pcr/custom-lamp-primers.png "Custom LAMP Primers") __Figure 1.__High-level overview of the main steps used in the manufacturing process for Custom LAMP Primers (steps upstream from Synthesis and downstream from Purification have been omitted for simplicity). ## __LAMP Primer Design__[](https://www.sigmaaldrich.com) For background on Custom LAMP Primer design as well as access to a complimentary design tool, please see the excellent resources available from [New England Biolabs](https://www.neb.com/faqs/2016/09/28/how-do-i-design-lamp-primers1).   ## Product Benefits - Amounts available to meet needs from R&D to commercialization - Consultation with our scientific team to set final specifications - Specialized purification, ensuring high-performance primers ## Product Features For anything marked as ‘Inquire’ below or If you have needs that are different from the other general specifications presented, please send a request to [dnaoligos@sial.com.](mailto:sirnarequest@milliporesigma.com) ### Custom LAMP Primers Specifications Quantities• 10 mg to 2 g (inquire for larger quantities) [Purification](https://www.sigmaaldrich.com/US/en/technical-documents/technical-article/genomics/dna-and-rna-purification/best-purification)\*• Desalt (undefined) & HPLC (≥85%) Sequence Lengths• 10 to 50 bases (inquire for longer lengths) [Modifications](https://www.sigmaaldrich.com/US/en/technical-documents/technical-article/genomics/qpcr/custom-dna-oligos-modifications)• Inquire for feasibility of modifications   [Quality Control](https://www.sigmaaldrich.com/US/en/technical-documents/technical-article/genomics/pcr/custom-dna-oligos-qc-qa)• 100% mass spectrometry • Analytical HPLC available  • Certificate of Analysis available Format• Supplied dry or in solution in tubes (inquire for feasibility of other formats) \*At minimum, we recommend that the FIP/BIP primers be purified via HPLC. ## Quality Assurance[](https://www.sigmaaldrich.com) At the foundation of our manufacturing processes is a robust [Quality Management System (QMS)](https://www.sigmaaldrich.com/US/en/technical-documents/technical-article/genomics/qpcr/oligonucleotide-quality-assurance-quality-management-system-components), which drives compliance to our following [Quality Registrations](https://www.sigmaaldrich.com/US/en/life-science/quality-and-regulatory-management/iso-certificates): - ISO 9001:2015 for manufacturing research-grade oligonucleotides - ISO 13485:2016 for manufacturing diagnostic-grade oligonucleotides - ISO 14001:2015 for effective environmental management ## SARS-CoV-2 LAMP Primers[](https://www.sigmaaldrich.com) In addition to being a robust method as described above, colorimetric RT-LAMP is rapidly growing in popularity as a molecular diagnostic, especially for SARS-CoV-2, because it allows for rapid detection with minimal instrumentation. Currently, several EUA (Emergency Use Authorization) tests use the primers in Table 1, which are described in the paper, [Enhancing colorimetric loop-mediated isothermal amplification speed and sensitivity with guanidine chloride3](https://doi.org/10.2144/btn-2020-0078). Direct testing by several end users has revealed that our Custom LAMP Primers have led to exceptional performance with the E1, N2, and As1e primer sets. ### SARS-CoV-2 Targets E1 Sequence Set Oligo NameSequenceTypical Primer Ratios\*Recommended Purification E1-F3TGAGTACGAACTTATGTACTCAT1XDesalt E1-B3TTCAGATTTTTAACACGAGAGT1XDesalt E1-FIPACCACGAAAGCAAGAAAAAGAAGTTCGTTTCGGAAGAGACAG8-10XHPLC E1-BIPTTGCTAGTTACACTAGCCATCCTTAGGTTTTACAAGACTCACGT8-10XHPLC E1-LFCGCTATTAACTATTAACG2XDesalt E1-LBGCGCTTCGATTGTGTGCGT2XDesalt | | | | | |-----------------|--------------------------------------------|------------------------|--------------------------| | N2 Sequence Set | | | | | Oligo Name | Sequence | Typical Primer Ratios* | Recommended Purification | | N2-F3 | ACCAGGAACTAATCAGACAAG | 1X | Desalt | | N2-B3 | GACTTGATCTTTGAAATTTGGATCT | 1X | Desalt | | N2-FIP | TTCCGAAGAACGCTGAAGCGGAACTGATTACAAACATTGGCC | 8-10X | HPLC | | N2-BIP | CGCATTGGCATGGAAGTCACAATTTGATGGCACCTGTGTA | 8-10X | HPLC | | N2-LF | GGGGGCAAATTGTGCAATTTG | 2X | Desalt | | N2-LB | CTTCGGGAACGTGGTTGACC | 2X | Desalt | | | | | | |-------------------|-----------------------------------------------------|------------------------|--------------------------| | As1e Sequence Set | | | | | Oligo Name | Sequence | Typical Primer Ratios* | Recommended Purification | | As1e-F3 | CGGTGGACAAATTGTCAC | 1X | Desalt | | As1e-B3 | CTTCTCTGGATTTAACACACTT | 1X | Desalt | | As1e-FIP | TCAGCACACAAAGCCAAAAATTTATTTTTCTGTGCAAAGGAAATTAAGGAG | 8-10X | HPLC | | As1e-BIP | TATTGGTGGAGCTAAACTTAAAGCCTTTTCTGTACAATCCCTTTGAGTG | 8-10X | HPLC | | As1e-LF | TTACAAGCTTAAAGAATGTCTGAACACT | 2X | Desalt | | As1e-LB | TTGAATTTAGGTGAAACATTTGTCACG | 2X | Desalt | Table 1. E1, N2, and As1e primer sets currently used with several EUA tests that detection SARS-CoV-2. Included are typical primer ratios and recommended purifications. \*Typical primer ratios means that FIP/BIP must be present at 8-10-fold higher than F3/B3, and LF/BF must be present at 2-fold higher for the LAMP chemistry to function properly. ### References 1\. Jiang YS, Bhadra S, Li B, Wu YR, Milligan JN, Ellington AD. 2015. Robust Strand Exchange Reactions for the Sequence-Specific, Real-Time Detection of Nucleic Acid Amplicons. Anal. Chem.. 87(6):3314-3320. [https://doi.org/10.1021/ac504387c](https://doi.org/10.1021/ac504387c) 2\. Maranhao A, Bhadra S, Paik I, Walker D, Ellington AD. An improved and readily available version of Bst DNA Polymerase for LAMP, and applications to COVID-19 diagnostics. [https://doi.org/10.1101/2020.10.02.20203356](https://doi.org/10.1101/2020.10.02.20203356) 3\. Zhang Y, Ren G, Buss J, Barry AJ, Patton GC, Tanner NA. 2020. Enhancing colorimetric loop-mediated isothermal amplification speed and sensitivity with guanidine chloride. BioTechniques. 69(3):178-185. [https://doi.org/10.2144/btn-2020-0078](https://doi.org/10.2144/btn-2020-0078) 4\. Huang X, Tang G, Ismail N, Wang X. 2022. Developing RT-LAMP assays for rapid diagnosis of SARS-CoV-2 in saliva. eBioMedicine. 75103736. [https://doi.org/10.1016/j.ebiom.2021.103736](https://doi.org/10.1016/j.ebiom.2021.103736) For technical assistance, please consult our [technical services group](mailto:oligotechserv@sial.com). __Related Product Categories__ - [Custom DNA Oligos & qPCR Probes](https://www.sigmaaldrich.com/US/en/products/molecular-biology-and-functional-genomics/oligos-and-qpcr-probes/custom-predesigned-dna-oligos-and-qpcr-probes) - [Custom & Predesigned RNA Oligos, siRNA Duplexes and Controls](https://www.sigmaaldrich.com/US/en/products/molecular-biology-and-functional-genomics/oligos-and-qpcr-probes/custom-predesigned-rna-oligos-sirna-duplexes-controls) Top __Sign In To Continue__ To continue reading please sign in or create an account. Sign In__Don't Have An Account?__Register An unknown error has occured.