Saltar al contenido
Merck

HMI2139

MISSION® microRNA Mimic

hsa-miR-5582-3p

Iniciar sesión para ver los precios por organización y contrato.

Seleccione un Tamaño

Cambiar Vistas

Acerca de este artículo

NACRES:
NA.51
UNSPSC Code:
12352200
Servicio técnico
¿Necesita ayuda? Nuestro equipo de científicos experimentados está aquí para ayudarle.
Permítanos ayudarle


product line

MISSION®

form

solid

mature sequence

UAAAACUUUAAGUGUGCCUAGG

Sanger mature/minor accession no.

Sanger microRNA accession no.

storage temp.

−20°C

Gene Information

General description

The ready-to-use MISSION miRNA mimics are small, double-stranded RNA molecules designed to mimic endogenous mature miRNA molecules when introduced into cells. miRNA are known to regulate gene expression in a variety of manners, including translational repression, mRNA cleavage and deadenylation. MISSION miRNA Mimics, a member of MISSION RNAi product family, provides miRNA researchers with a range of options from individual MISSION mimics to a full library of human miRNA mimics based on latest version of miRBase (currently hosted by the University of Manchester, previously hosted by the Sanger Institute).

  • Optimized and ready for transfection.
  • Novel MISSION miRNA mimic design has been functionally tested for knockdown efficiency against natural miRNA targets.
  • Unique MISSION miRNA mimic design significantly reduces possible sense strand off target effects.
  • Available as a whole human library and individual miRNA targets.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Clase de almacenamiento

13 - Non Combustible Solids

¿Qué está pasando?

WGK 3

Punto de inflamación (°F)

Not applicable

Punto de inflamación (°C)

Not applicable



Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos