Autenticati per visualizzare i prezzi organizzativi e contrattuali.
Scegli un formato
Cambia visualizzazione
Informazioni su questo articolo
NACRES:
NA.51
UNSPSC Code:
12352200
Servizio Tecnico
Hai bisogno di aiuto? Il nostro team di scienziati qualificati è a tua disposizione.
Permettici di aiutartiproduct line
MISSION®
form
solid
mature sequence
UAAAACUUUAAGUGUGCCUAGG
Sanger mature/minor accession no.
Sanger microRNA accession no.
storage temp.
−20°C
Gene Information
human ... hsa-mir-5582(100847020)
General description
The ready-to-use MISSION miRNA mimics are small, double-stranded RNA molecules designed to mimic endogenous mature miRNA molecules when introduced into cells. miRNA are known to regulate gene expression in a variety of manners, including translational repression, mRNA cleavage and deadenylation. MISSION miRNA Mimics, a member of MISSION RNAi product family, provides miRNA researchers with a range of options from individual MISSION mimics to a full library of human miRNA mimics based on latest version of miRBase (currently hosted by the University of Manchester, previously hosted by the Sanger Institute).
- Optimized and ready for transfection.
- Novel MISSION miRNA mimic design has been functionally tested for knockdown efficiency against natural miRNA targets.
- Unique MISSION miRNA mimic design significantly reduces possible sense strand off target effects.
- Available as a whole human library and individual miRNA targets.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Classe di stoccaggio
13 - Non Combustible Solids
Che succede?
WGK 3
Punto di infiammabilità (°F)
Not applicable
Punto di infiammabilità (°C)
Not applicable
Scegli una delle versioni più recenti:
Possiedi già questo prodotto?
I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.