Skip to Content

MSTUD0971

MISSION® Synthetic microRNA Inhibitor, Mouse

mmu-miR-767

Sign In to View Organizational & Contract Pricing.

Select a Size

Change View

About This Item

NACRES:
NA.51
UNSPSC Code:
12352200
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist


product line

MISSION®

form

solid

mature sequence

UGCACCAUGGUUGUCUGAGCA

Sanger mature/minor accession no.

Sanger microRNA accession no.

storage temp.

−20°C

General description

Individual synthetic microRNA inhibitors were designed using a proprietary algorithm, which is based on the work of Haraguchi, T, et al. and in collaboration with Dr. Hideo Iba, University of Tokyo. This algorithm utilizes the tough decoy (TuD) design. miRNA are known to regulate gene expression in a variety of manners, including translational repression, mRNA cleavage and deadenylation.

The MISSION synthetic miRNA Inhibitors are small, double-stranded RNA molecules designed to inhibit a specific mature miRNA. The miRNA inhibitors were designed using the mature miRNA sequence information from miRBase and are 2′-O-methylated RNA duplexes with a miRNA binding site on each strand. Optimal miRNA inhibition is provided after transfection due to the robust secondary structure of the inhibitor.

  • Long lasting inhibition at very low dosage
  • Excellent resistance to cellular nucleases
  • Custom synthesis available for a variety of species

Two negative controls are available: Arabidopsis thaliana sequence (NCSTUD001) and Caenorhabditis elegans sequence (NCSTUD002)

Other Notes

Based on miRBase V19

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Pictograms

Health hazard

Signal Word

Warning

Hazard Codes

Precautionary Statements

Hazard Classifications

STOT RE 2 Inhalation

Target Organs

Respiratory Tract

Storage Class

11 - Combustible Solids

WGK

WGK 3

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable



Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library