Saltar al contenido

HSTUD2129

MISSION® Synthetic microRNA Inhibitor, Human

hsa-miR-365b-5p

Iniciar sesión para ver los precios por organización y contrato.

Seleccione un Tamaño

Cambiar Vistas

Acerca de este artículo

NACRES:
NA.51
UNSPSC Code:
12352200
Servicio técnico
¿Necesita ayuda? Nuestro equipo de científicos experimentados está aquí para ayudarle.
Permítanos ayudarle


product line

MISSION®

form

solid

mature sequence

AGGGACUUUCAGGGGCAGCUGU

Sanger mature/minor accession no.

Sanger microRNA accession no.

storage temp.

−20°C

General description

Individual synthetic microRNA inhibitors were designed using a proprietary algorithm, which is based on the work of Haraguchi, T, et al. and in collaboration with Dr. Hideo Iba, University of Tokyo. This algorithm utilizes the tough decoy (TuD) design. miRNA are known to regulate gene expression in a variety of manners, including translational repression, mRNA cleavage and deadenylation.

The MISSION synthetic miRNA Inhibitors are small, double-stranded RNA molecules designed to inhibit a specific mature miRNA. The miRNA inhibitors were designed using the mature miRNA sequence information from miRBase and are 2′-O-methylated RNA duplexes with a miRNA binding site on each strand. Optimal miRNA inhibition is provided after transfection due to the robust secondary structure of the inhibitor.

  • Long lasting inhibition at very low dosage
  • Excellent resistance to cellular nucleases
  • Custom synthesis available for a variety of species

Two negative controls are available: Arabidopsis thaliana sequence (NCSTUD001) and Caenorhabditis elegans sequence (NCSTUD002)

Other Notes

Based on miRBase V19

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Pictogramas

Health hazard

Palabra de advertencia

Warning

Códigos de peligro

Indicaciones de precaución

Hazard Classifications

STOT RE 2 Inhalation

Órganos diana

Respiratory Tract

Clase de almacenamiento

11 - Combustible Solids

¿Qué está pasando?

WGK 3

Punto de inflamación (°F)

Not applicable

Punto de inflamación (°C)

Not applicable



Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos