Iniciar sesión para ver los precios por organización y contrato.
Seleccione un Tamaño
Cambiar Vistas
| Talla/SKU | Disponibilidad | Precio |
|---|
Acerca de este artículo
NACRES:
NA.51
UNSPSC Code:
41105324
eCl@ss:
32119211
En este momento no podemos mostrarle ni los precios ni la disponibilidad Póngase en contacto con el Servicio técnico
Servicio técnico
¿Necesita ayuda? Nuestro equipo de científicos experimentados está aquí para ayudarle.
Permítanos ayudarleQuality Segment
product line
MISSION®
form
solid
mature sequence
UAACAGUCUACAGCCAUGGUCG
Sanger mature/minor accession no.
microRNA accession no.
MI0000158
storage temp.
−20°C
General description
Individual synthetic microRNA inhibitors were designed using a proprietary algorithm, which is based on the work of Haraguchi, T, et al. and in collaboration with Dr. Hideo Iba, University of Tokyo. This algorithm utilizes the tough decoy (TuD) design. miRNA are known to regulate gene expression in a variety of manners, including translational repression, mRNA cleavage and deadenylation.
The MISSION synthetic miRNA Inhibitors are small, double-stranded RNA molecules designed to inhibit a specific mature miRNA. The miRNA inhibitors were designed using the mature miRNA sequence information from miRBase and are 2′-O-methylated RNA duplexes with a miRNA binding site on each strand. Optimal miRNA inhibition is provided after transfection due to the robust secondary structure of the inhibitor.
Two negative controls are available: Arabidopsis thaliana sequence (NCSTUD001) and Caenorhabditis elegans sequence (NCSTUD002)
The MISSION synthetic miRNA Inhibitors are small, double-stranded RNA molecules designed to inhibit a specific mature miRNA. The miRNA inhibitors were designed using the mature miRNA sequence information from miRBase and are 2′-O-methylated RNA duplexes with a miRNA binding site on each strand. Optimal miRNA inhibition is provided after transfection due to the robust secondary structure of the inhibitor.
- Long lasting inhibition at very low dosage
- Excellent resistance to cellular nucleases
- Custom synthesis available for a variety of species
Two negative controls are available: Arabidopsis thaliana sequence (NCSTUD001) and Caenorhabditis elegans sequence (NCSTUD002)
Other Notes
Based on miRBase V19
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Palabra de advertencia
Warning
Códigos de peligro
Indicaciones de precaución
Hazard Classifications
STOT RE 2 Inhalation
Órganos diana
Respiratory Tract
Clase de almacenamiento
11 - Combustible Solids
¿Qué está pasando?
WGK 3
Punto de inflamación (°F)
Not applicable
Punto de inflamación (°C)
Not applicable
Elija entre una de las versiones más recientes:
¿Ya tiene este producto?
Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.
