Przejdź do zawartości
Merck

HMI2139

MISSION® microRNA Mimic

hsa-miR-5582-3p

Zaloguj się, aby wyświetlić ceny organizacyjne i kontraktowe.

Wybierz wielkość

Zmień widok

Informacje o tej pozycji

NACRES:
NA.51
UNSPSC Code:
12352200
Pomoc techniczna
Potrzebujesz pomocy? Nasz zespół doświadczonych naukowców chętnie Ci pomoże.
Pozwól nam pomóc


product line

MISSION®

form

solid

mature sequence

UAAAACUUUAAGUGUGCCUAGG

Sanger mature/minor accession no.

Sanger microRNA accession no.

storage temp.

−20°C

Gene Information

General description

The ready-to-use MISSION miRNA mimics are small, double-stranded RNA molecules designed to mimic endogenous mature miRNA molecules when introduced into cells. miRNA are known to regulate gene expression in a variety of manners, including translational repression, mRNA cleavage and deadenylation. MISSION miRNA Mimics, a member of MISSION RNAi product family, provides miRNA researchers with a range of options from individual MISSION mimics to a full library of human miRNA mimics based on latest version of miRBase (currently hosted by the University of Manchester, previously hosted by the Sanger Institute).

  • Optimized and ready for transfection.
  • Novel MISSION miRNA mimic design has been functionally tested for knockdown efficiency against natural miRNA targets.
  • Unique MISSION miRNA mimic design significantly reduces possible sense strand off target effects.
  • Available as a whole human library and individual miRNA targets.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Ta strona może zawierać tekst przetłumaczony maszynowo.


Klasa składowania

13 - Non Combustible Solids

Co się dzieje?

WGK 3

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable



Wybierz jedną z najnowszych wersji:

Certyfikaty analizy (CoA)

Lot/Batch Number

Nie widzisz odpowiedniej wersji?

Jeśli potrzebujesz konkretnej wersji, możesz wyszukać konkretny certyfikat według numeru partii lub serii.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów