HMI2139

MISSION^® microRNA Mimic

hsa-miR-5582-3p

• NACRES: NA.51
• UNSPSC Code: 12352200

Properties

• product line: MISSION^®
• form: solid
• mature sequence: UAAAACUUUAAGUGUGCCUAGG
• Sanger mature/minor accession no.: MIMAT0022280
• Sanger microRNA accession no.: MI0019138
• storage temp.: −20°C
• Gene Information: human ... hsa-mir-5582(100847020)

Description

General description

The ready-to-use MISSION miRNA mimics are small, double-stranded RNA molecules designed to mimic endogenous mature miRNA molecules when introduced into cells. miRNA are known to regulate gene expression in a variety of manners, including translational repression, mRNA cleavage and deadenylation. MISSION miRNA Mimics, a member of MISSION RNAi product family, provides miRNA researchers with a range of options from individual MISSION mimics to a full library of human miRNA mimics based on latest version of miRBase (currently hosted by the University of Manchester, previously hosted by the Sanger Institute).

• Optimized and ready for transfection.
• Novel MISSION miRNA mimic design has been functionally tested for knockdown efficiency against natural miRNA targets.
• Unique MISSION miRNA mimic design significantly reduces possible sense strand off target effects.
• Available as a whole human library and individual miRNA targets.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Safety Information

• Storage Class: 13 - Non Combustible Solids
• WGK: WGK 3
• Flash Point (°F): Not applicable
• Flash Point (°C): Not applicable