Accéder au contenu

HSTUD0807

MISSION® Synthetic microRNA Inhibitor, Human

hsa-miR-584-5p

Synonyme(s) :

hsa-miR-584

Se connecter pour consulter les tarifs organisationnels et contractuels.

Sélectionner une taille de conditionnement

Changer de vue

A propos de cet article

NACRES:
NA.51
UNSPSC Code:
12352200
Service technique
Besoin d'aide ? Notre équipe de scientifiques expérimentés est là pour vous.
Laissez-nous vous aider


product line

MISSION®

form

solid

mature sequence

UUAUGGUUUGCCUGGGACUGAG

Sanger mature/minor accession no.

Sanger microRNA accession no.

storage temp.

−20°C

General description

Individual synthetic microRNA inhibitors were designed using a proprietary algorithm, which is based on the work of Haraguchi, T, et al. and in collaboration with Dr. Hideo Iba, University of Tokyo. This algorithm utilizes the tough decoy (TuD) design. miRNA are known to regulate gene expression in a variety of manners, including translational repression, mRNA cleavage and deadenylation.

The MISSION synthetic miRNA Inhibitors are small, double-stranded RNA molecules designed to inhibit a specific mature miRNA. The miRNA inhibitors were designed using the mature miRNA sequence information from miRBase and are 2′-O-methylated RNA duplexes with a miRNA binding site on each strand. Optimal miRNA inhibition is provided after transfection due to the robust secondary structure of the inhibitor.

  • Long lasting inhibition at very low dosage
  • Excellent resistance to cellular nucleases
  • Custom synthesis available for a variety of species

Two negative controls are available: Arabidopsis thaliana sequence (NCSTUD001) and Caenorhabditis elegans sequence (NCSTUD002)

Other Notes

Based on miRBase V19

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Pictogrammes

Health hazard

Mot-clé

Warning

Codes de danger

Mentions de précaution

Hazard Classifications

STOT RE 2 Inhalation

Organes cibles

Respiratory Tract

Classe de stockage

11 - Combustible Solids

Que se passe-t-il ?

WGK 3

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable



Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents