Accéder au contenu
MilliporeSigma

MLTUD1237

MISSION® Lenti microRNA Inhibitor, Mouse

mmu-miR-5136

Synonyme(s) :

Tough Decoy, TuD

Se connecter pour consulter les tarifs organisationnels et contractuels.

Sélectionner une taille de conditionnement

Changer de vue

A propos de cet article

NACRES:
NA.51
UNSPSC Code:
41106609
Concentration:
≥1x106 VP/ml (via p24 assay)
Mature sequence:
AUAUGCGAGGGAACUACUGG
Service technique
Besoin d'aide ? Notre équipe de scientifiques expérimentés est là pour vous.
Laissez-nous vous aider


product line

MISSION®

form

liquid

concentration

≥1x106 VP/ml (via p24 assay)

mature sequence

AUAUGCGAGGGAACUACUGG

Sanger mature/minor accession no.

Sanger microRNA accession no.

shipped in

dry ice

storage temp.

−70°C

General description

Individual lenti microRNA inhibitors are designed using a proprietary algorithm, which is based on the work of Haraguchi, T, et al. and in collaboration with Dr. Hideo Iba, University of Tokyo. This algorithm utilizes the tough decoy (TuD) design. miRNA are known to regulate gene expression in a variety of manners, including translational repression, mRNA cleavage and deadenylation. The lentiviral microRNA Inhibitors are cloned into the TRC2-pLKO-puro vector. Co-transfection of this vector into the appropriate cell line with compatible packaging plasmids produces viral particles that can be used to transduce mammalian cells. Additionally, the Woodchuck Hepatitis Post-Transcriptional Regulatory Element2 (WPRE) is included, allowing for enhanced expression of transgenes delivered by lentiviral vectors. This lentiviral vector also carries a puromycin resistance gene for selection of cells.

Allows for potent inhibition of the desired miRNA
Lentiviral delivery format allows for efficient delivery of the inhibitor into a wide variety of cell types
Enables long-term inhibition without repeat transfection

Other Notes

Based on miRBase V19 Mature ID

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Classe de stockage

12 - Non Combustible Liquids

Que se passe-t-il ?

WGK 3

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable



Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents