Skip to Content
Merck

EHU143071

MISSION® esiRNA

targeting human BAG3

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

Product Name

MISSION® esiRNA, targeting human BAG3

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CCGCAAAGAGGTGGATTCTAAACCTGTTTCCCAGAAGCCCCCACCTCCCTCTGAGAAGGTAGAGGTGAAAGTTCCCCCTGCTCCAGTTCCTTGTCCTCCTCCCAGCCCTGGCCCTTCTGCTGTCCCCTCTTCCCCCAAGAGTGTGGCTACAGAAGAGAGGGCAGCCCCCAGCACTGCCCCTGCAGAAGCTACACCTCCAAAACCAGGAGAAGCCGAGGCTCCCCCAAAACATCCAGGAGTGCTGAAAGTGGAAGCCATCCTGGAGAAGGTACAGGGGCTGGAGCAGGCTGTAGACAACTTTGAAGGCAAGAAGACTGACAAAAAGTACCTGATGATCGAAGAGTATTTGACCAAAGAGCTGCTGGCCCTGGATTCAGTGGACCCCGAGGGACGAGCCGATGTGCGTCAGGCCAGGAGAGACGGTGTCAGGAAGGTTCAGACCATCTTGGAAAAACTTGAACAGAAAGCCATTGATGTCCCAGGTCAAGTCCAG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Fei Song et al.
Oncotarget, 8(56), 95392-95400 (2017-12-10)
Bcl2-associated athanogene 3 (BAG3) has been reported to be involved in aggressive progression of many tumors. In the present study, we examined the expression of BAG3 in human cervical cancer (CC) tissues and investigated the role of BAG3 in SiHa
Patrick Antonietti et al.
Molecular cancer therapeutics, 16(1), 156-168 (2016-10-26)
Malignant gliomas exhibit a high intrinsic resistance against stimuli triggering apoptotic cell death. HSF1 acts as transcription factor upstream of HSP70 and the HSP70 co-chaperone BAG3 that is overexpressed in glioblastoma. To specifically target this resistance mechanism, we applied the
Joseph M McClung et al.
Circulation, 136(3), 281-296 (2017-04-27)
Critical limb ischemia is a manifestation of peripheral artery disease that carries significant mortality and morbidity risk in humans, although its genetic determinants remain largely unknown. We previously discovered 2 overlapping quantitative trait loci in mice, We treated mice with
Shuang Qiu et al.
Oncology reports, 38(1), 309-316 (2017-06-20)
Ovarian cancer is the most lethal disease among all gynecological malignancies. Interval cytoreductive surgery and cisplatin‑based chemotherapy are the recommended therapeutic strategies. However, acquired resistance to cisplatin remains a big challenge for the overall survival and prognosis in ovarian cancer.
Shuang Qiu et al.
Oncology letters, 18(2), 1969-1978 (2019-08-20)
Epithelial ovarian cancer (EOC) is one of the most common malignant gynecological tumors. Interval cytoreductive surgery and cisplatin-based chemotherapy are the standard treatments. However, acquired resistance to cisplatin presents a major challenge for improving the overall survival and prognosis of

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service