Skip to Content
Merck

EHU063841

MISSION® esiRNA

targeting human LRPPRC

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

Product Name

MISSION® esiRNA, targeting human LRPPRC

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CGGCAAGTATGTAGGCCTTGTAAGAGTATTGGCAAAGCATGGCAAGCTCCAAGATGCTATTAACATTCTGAAGGAGATGAAAGAGAAGGATGTTCTTATCAAAGATACAACAGCCTTGTCCTTTTTCCACATGCTAAATGGCGCAGCTTTAAGAGGTGAAATTGAAACAGTAAAACAGTTGCATGAAGCCATCGTGACTCTAGGGTTAGCAGAACCATCCACCAACATAAGTTTCCCATTGGTCACTGTACACTTGGAAAAGGGCGACCTATCTACTGCTCTTGAGGTCGCCATTGACTGCTATGAAAAGTATAAAGTATTACCAAGGATTCATGATGTCTTGTGTAAACTGGTAGAGAAAGGCGAGACTGATCTAATTCAGAAAGCAATGGACTTTGTGAGCCAAGAACAAGGTG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Stephany Corrêa et al.
Epigenetics, 9(8), 1172-1183 (2014-08-05)
One of the potential mechanisms of imatinib mesylate (IM) resistance in chronic myeloid leukemia (CML) is increased level of P-glycoprotein (Pgp). Pgp is an efflux pump capable of activating the multidrug resistance (MDR) phenotype. The gene encoding Pgp (ABCB1) has
Keiko Fujimoto et al.
Molecular pharmacology, 88(4), 660-675 (2015-07-17)
Tocilizumab (TCZ), a humanized anti-interleukin-6 (IL-6) receptor (IL-6R) monoclonal antibody, abrogates signal transducer protein gp130-mediated IL-6 signaling by competitively inhibiting the binding of IL-6 to the receptor, and shows clinical efficacy in autoimmune and inflammatory diseases. Despite accumulating evidence for

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service