Sequencing Primers
We have designed a range of forward and reverse sequencing primers that allow you to sequence any insert that you make into a particular position within any of our SnapFast™ expression vectors. Other vectors will require that you design your own primers. Where possible, the binding sites for each of these primers is conserved. Each primer has been designed to the following parameters:
GC content: 50-55 %
Melting point (TM): 55-60 °C
Base Pairs (BP): 18-22 nucleotides
Primer dimer: No
2ndry structure: None-Weak


Sequencing inserts in the Bgl2 site:
Forward BglII (primer binds between AsiSI and Bgl2 and reads towards Bgl2)
Primer name: OGP-F1
Sequence: TCGTTGCGTTACACACAC
TM: 59 °C
BP: 18
GC: 50%
Dimer: No
2ndry structure: None
Reverse Bgl II (primer binds between NotI and Bgl2 and reads towards Bgl2)
Primer name: OGP-R1
Sequence: TGTGTCGAGTGGATGGTAG
TM: 59.67 °C
BP: 19
GC: 52.6%
Dimer: No
2ndry structure: None
Sequencing inserts between NotI – XbaI (sequences the MCS):
Forward NotI-XbaI (primer binds between BglII and NotI and reads towards NotI)
Primer name: OGP-F2
Sequence: TGTCGATCCTACCATCCA
TM: 60 °C
BP: 18
GC: 50%
Dimer: No
2ndry structure: Very weak
Reverse XbaI-NotI (primer binds between CIaI and XbaI and reads towards XbaI)
Primer name: OGP-R2
Sequence: AGTCAGTCAGTGCAGGAG
TM: 56 °C
BP: 18
GC: 55%
Dimer: No
2ndry structure: None
Sequencing inserts between ClaI – NheI (sequences the fusion MCS):
Forward ClaI-NheI (primer binds between XbaI and BsgI and reads towards BsgI)
Primer name: OGP-F3
Sequence: AGTTGTCTCCTCCTGCACT
TM: 58.97 °C
BP: 19
GC: 53%
Dimer: No
2ndry structure: Very weak
Reverse NheI-ClaI (primer binds between SbfI and NheI and reads towards NheI)
Primer name: OGP-R3
Sequence: AGCTGAAGGTACGCTGTATC
TM: 58.53 °C
BP: 20
GC: 50%
Dimer: No
2ndry structure: Weak
Sequencing inserts in the SbfI site:
Forward SbfI (primer binds between NheI and SbfI and reads towards SbfI). These primer sequences were changed in January 2014 because in some plasmids low level homology was causing mixed reads.
Primer name: OGP-F4
Sequence: GGATTGCTATCTACCGG
TM: 55 °C
BP: 17
GC: 53%
Dimer: No
2ndry structure: None
Reverse SbfI (primer binds between PacI and SbfI and reads towards SbfI)
Primer name: OGP-R4
Sequence: CCAAGGTAACCAATGAG
TM: 53 °C
BP: 17
GC: 47%
Dimer: No
2ndry structure: None
Sequencing inserts in the PacI site:
Forward PacI (primer binds between SbfI and PacI and reads towards PacI)
Primer name: OGP-F5
Sequence: CTCATTGGTTACCTTGGG
TM: 57.8 °C
BP: 18
GC: 50%
Dimer: No
2ndry structure: None
Reverse PacI (primer binds between SwaI and PacI and reads towards PacI)
Primer name: OGP-R5
Sequence: ACAAGTCGATCTCGCCAA
TM: 62 °C
BP: 18
GC: 50%
Dimer: No
2ndry structure: None
Sequencing inserts in the SwaI site:
Forward SwaI (primer binds between PacI and SwaI and reads towards SwaI)
Primer name: OGP-F6
Sequence: TGGTCCTTGCTATTGCAC
TM: 59.79 °C
BP: 18
GC: 50%
Dimer: No
2ndry structure: Weak
Reverse SwaI (primer binds between FseI and SwaI and reads towards SwaI)
Primer name: OGP-R6
Sequence: CAAGATGGATCGGACGAA
TM: 62 °C
BP: 18
GC: 50%
Dimer: No
2ndry structure: None
Sequencing inserts in the FseI site:
Forward FseI (primer binds between SwaI and FseI and reads towards FseI)
Primer name: OGP-F7
Sequence: GATCCATCTTGCAGGCTAC
TM: 59.78 °C
BP: 19
GC: 53%
Dimer: No
2ndry structure: None
Reverse FseI (primer binds between AscI and FseI and reads towards FseI)
Primer name: OGP-R7
Sequence: GGAGTAATACCTGGCGATAG
TM: 57.7 °C
BP: 20
GC: 50%
Dimer: No
2ndry structure: None
Sequencing inserts in the AscI site:
Forward AscI (primer binds between FseI and AscI and reads towards AscI)
Primer name: OGP-F8
Sequence: TCCCGATCTATCCGAGAT
TM: 59.51 °C
BP: 18
GC: 50%
Dimer: No
2ndry structure: Weak
Reverse AscI (primer binds between PmeI and AscI and reads towards AscI)
Primer name: OGP-R8
Sequence: ATCGTCGAGACTCGCAC
TM: 61.24 °C
BP: 18
GC: 55%
Dimer: No
2ndry structure: Weak
Sequencing inserts in the PmeI site:
Forward PmeI (primer binds between AscI and PmeI and reads towards PmeI)
Primer name: OGP-F9
Sequence: CAGGAAGTCCAATCGTCAG
TM: 60.85 °C
BP: 19
GC: 53%
Dimer: No
2ndry structure: None
Reverse PmeI (primer binds between AsiSI and PmeI and reads towards PmeI)
Primer name: OGP-R9
Sequence: CTCGAAACGACGGAGATT
TM: 60.3 °C
BP: 18
GC: 50%
Dimer: No
2ndry structure: Weak
Sequencing inserts in the AsiSI site:
Forward AsiSI (primer binds between PmeI and AsiSI and reads towards AsiSI)
Primer name: OGP-F10
Sequence: GAATCTCGTCAGCTATCGTC
TM: 58.97 °C
BP: 20
GC: 50%
Dimer: No
2ndry structure: None
Reverse AsiSI (primer binds between BglII and AsiSI and reads towards AsiSI)
Primer name: OGP-R10
Sequence: CCTGTGGAGCTAATGGTC
TM: 58 °C
BP: 18
GC: 55%
Dimer: No
2ndry structure: None
| Plasmid Product Name | Product No. | Application |
|---|---|---|
| Most Popular Bacterial Reporter Genes | ||
| pSF-OXB20-BetaGal | OGS207 | RecA promoter driving b-galactosidase |
| pSF-OXB20-Fluc | OGS412 | OXB20 promoter driving firefly luciferase |
| Most Popular Bacterial Promoters | ||
| pSF-OXB20 | OGS50 | OXB20 promoter (strongest expression) |
| pSF-OXB1 | OGS553 | OXB1 promoter (weakest expression) |
| pSF-T7/LacO | OGS500 | T7 promoter with lac operon (inducible expression) |
| pSF-Tac | OGS501 | Tac promoter (IPTG inducible expression) |
| pSF-LacI | OGS502 | LacI promoter (regulated expression) |
| Most Popular Mammalian Reporter Genes | ||
| pSF-CMV-PGK-Fluc | OGS388 | Dual promoters driving firefly luciferase |
| pSF-CMV-RLuc | OGS103 | CMV promoter driving sea pansy luciferase |
| pSF-CMV-Ub-BetaGal AscI | OGS158 | Dual promoters driving b-galactosidase |
| pSF-CMV-FMDV-daGFP | OGS289 | Dual promoters driving IRES daGFP |
| pSF-CMV-RSV-SEAP AscI | OGS17 | Dual promoters driving SEAP |
| Most Popular Mammalian Promoters | ||
| pSF-CMV-Kan | OGS10 | CMV promoter (strongest expression) |
| pSF-CAG-Kan | OGS505 | Synthetic CAG promoter (strong and stable expression) |
| pSF-EF1 Alpha | OGS43 | EF1a promoter (moderate but stable expression) |
| Most Popular Mammalian Selection Markers | ||
| pSF-CMV-PGK-Puro | OGS394 | Dual promoter for expressing two genes (puromycin) |
| pSF-CMV-FMDV-Hygro | OGS292 | Dual promoter expressing one gene (hygromycin) |
| pSF-CMV-Blast | OGS588 | CMV promoter (blasticidin) |
| pSF-CMV-Ub-Neo/G418 AscI | OGS22 | Dual promoter expressing one gene (G418) |
| Most Popular Mammalian Protein Tags | ||
| pSF-CMV-Puro-NH2-10His-EKT | OGS1157 | N-term 10His affinity tag & EKT cleavage tag |
| pSF-CMV-Puro-NH2-FLAG®-6His-EKT | OGS1175 | N-term FLAG®, 6His affinity tags & EKT cleavage tag |
| pSF-CMV-Puro-COOH-TEV-10His | OGS1120 | C-term 10His affinity tag & TEV cleavage tag |
| pSF-CMV-Puro-COOH-TEV-FLAG®-6His | OGS1232 | C-term FLAG®, 6His affinity tags & TEV cleavage tag |
| Most Popular Bacterial Protein Tags | ||
| pSF-OXB20-NH2-10His-EKT | OGS2806 | N-term 10His affinity tag & EKT cleavage tag |
| pSF-OXB20-NH2-FLAG®-6His-EKT | OGS2828 | N-term FLAG®, 6His affinity tags & EKT cleavage tag |
| pSF-OXB20-COOH-TEV-10His | OGS2767 | C-term 10His affinity tag & TEV cleavage tag |
| pSF-OXB20-COOH-TEV-FLAG®-6His | OGS2891 | C-term FLAG®, 6His affinity tags & TEV cleavage tag |
| Most Popular Yeast Protein Tags | ||
| pSF-TEF1-NH2-10His-EKT | OGS1649 | N-term 10His affinity tag & EKT cleavage tag |
| pSF-TEF1-NH2-FLAG®-6His-EKT | OGS1658 | N-term FLAG®, 6His affinity tags & EKT cleavage tag |
| pSF-TEF1-COOH-TEV-10His | OGS1913 | C-term 10His affinity tag & TEV cleavage tag |
| pSF-TEF1-COOH-TEV-FLAG®-6His | OGS1969 | C-term FLAG®, 6His affinity tags & TEV cleavage tag |
| Other Popular Plasmids | ||
| pSF-OXB20-NH2-OmpA | OGS3099 | Bacterial promoter with N-term Omp secretion signal |
| pSF-CMV-Puro-NH2-InsulinSP | OGS1436 | Mammalian promoter with N-term Insulin secretion signal |
| pSF-CMV-SC101 | OGS13 | Mammalian promoter with low copy number |
| pSF-TEF1-NH2-Amy | OGS1817 | Yeast Promoter with N-term Amy secretion signal |
| pSF-TEFI-TPI1-Fluc-URA3 | OGS545 | Yeast promoter driving firefly luciferase (plus URA3 selection) |
| pSF-Ad5 | OGS268 | Adenoviral cloning vector |
| pSF-CMV-CMV-SbfI-Ub-Puro | OGS597 | Dual CMV promoters for expressing two genes |
| pSF-PromMCS-FLuc | OGS369 | Promoterless MCS allows you to insert your choice |
| Popular Plasmid Sets | ||
| Mammalian FLAG® Tag Pack | PPS2393 | Four plasmids to optimize FLAG® tag use with TEV tag |
| Mammalian Promoters Pack | PPS2356 | Six plasmids to optimize expression based on promoter strength |
| Bacterial FLAG® Tag Pack | PPS2394 | Four plasmids to optimize FLAG® tag use with TEV tag |
| Yeast Signal Peptide Pack | PPS2381 | Nine plasmids to optimize protein secretion signal |
Materials
Response not successful: Received status code 500
계속 읽으시려면 로그인하거나 계정을 생성하세요.
계정이 없으십니까?