Skip to Content
Merck

EHU145321

MISSION® esiRNA

targeting human ITGA11

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

Product Name

MISSION® esiRNA, targeting human ITGA11

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ACACCACAGGGATGTGTTCAAGAGTCAACTCCAACTTCAGGTTCTCCAAGACCGTGGCCCCAGCTCTCCAAAGGTGCCAGACCTACATGGACATCGTCATTGTCCTGGATGGCTCCAACAGCATCTACCCCTGGGTGGAGGTTCAGCACTTCCTCATCAACATCCTGAAAAAGTTTTACATTGGCCCAGGGCAGATCCAGGTTGGAGTTGTGCAGTATGGCGAAGATGTGGTGCATGAGTTTCACCTCAACGACTACAGGTCTGTAAAAGATGTGGTGGAAGCTGCCAGCCACATTGAGCAGAGAGGAGGAACAGAGACCCGGACGGCATTTGGCATTGAATTTGCACGCTCAGAGGCTTTCCAGAAGGGTGGAAGGAAAGGAGCCAAGAAGGTGATGATTGTCATCACAGATGGGGAGTCCCACGACAGCCCAGACCTGGAGAAGGTGATCCA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Pugazendhi Erusappan et al.
Scientific reports, 9(1), 15283-15283 (2019-10-28)
Integrin α11β1 is a collagen-binding integrin, which is receiving increasing attention in the context of wound healing and fibrosis. Although α11β1 integrin displays similar collagen specificity to α2β1 integrin, both integrins have distinct in vivo functions. In this context, the
Katherine Martin et al.
Nature communications, 7, 12502-12502 (2016-08-19)
Fibrosis due to extracellular matrix (ECM) secretion from myofibroblasts complicates many chronic liver diseases causing scarring and organ failure. Integrin-dependent interaction with scar ECM promotes pro-fibrotic features. However, the pathological intracellular mechanism in liver myofibroblasts is not completely understood, and

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service