Saltar al contenido
MilliporeSigma

Saltar a

MLMIR1237

MISSION® Lenti microRNA, Mouse

mmu-miR-5136

Iniciar sesión para ver los precios por organización y contrato.

Acerca de este artículo

NACRES:
NA.51
UNSPSC Code:
41106609
Concentration:
≥1x106 VP/ml (via p24 assay)
Mature sequence:
AUAUGCGAGGGAACUACUGG


product line

MISSION®

form

liquid

concentration

≥1x106 VP/ml (via p24 assay)

mature sequence

AUAUGCGAGGGAACUACUGG

Sanger mature/minor accession no.

Sanger microRNA accession no.

shipped in

dry ice

storage temp.

−70°C

General description

Sigma′s Mission Lenti-miRs express miRNAs from a common backbone, whose structure meets requirements for accurate Dicer processing and a partially complementary strand is designed to mimic the base pairing pattern in the backbone structure using a proprietary algorithm. Oligos containing the microRNA sequences are cloned into the TRC2-pLKO-puro vector. Each miRNA construct has been cloned and sequence verified. Mature microRNA sequences are obtained from miRBase.Lentiviral transduction particles are produced from sequence-verified lentiviral plasmid vectors. Oligos containing the microRNA sequences are cloned into the TRC2-pLKO-puro vector. Co-transfection of this vector into the appropriate cell line with compatible packaging plasmids produces viral particles that can be used to transduce mammalian cells. The polymerase II promoter, elongation factor 1 alpha (EF1A), was chosen to drive miRNA expression needed for reverse transcription of viral RNA and integration of viral DNA into the host cell genome. Additionally, the Woodchuck Hepatitis Post-Transcriptional Regulatory element allowing for enhanced expression of transgenes delivered by lentiviral vectors. This lentiviral vector also carries a puromycin resistance gene for selection of cells. Unlike murine-based MMLV or MSCV retroviral systems, lentiviral-based particles permit efficient infection and integration of the specific miRNA construct into differentiated and non-dividing cells, such as neurons and dendritic cells.

Other Notes

Based on miRBase V20 Mature ID
Two negative controls are available: NCLMIR001 and NCLMIR002

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Clase de almacenamiento

12 - Non Combustible Liquids

¿Qué está pasando?

WGK 3

Punto de inflamación (°F)

Not applicable

Punto de inflamación (°C)

Not applicable



Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documentos section.

Si necesita más asistencia, póngase en contacto con Atención al cliente

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos




Questions

Reviews

No rating value

Active Filters