Passa al contenuto

HSTUD2201

MISSION® Synthetic microRNA Inhibitor, Human

hsa-miR-6510-3p

Autenticati per visualizzare i prezzi organizzativi e contrattuali.

Scegli un formato

Cambia visualizzazione

Informazioni su questo articolo

NACRES:
NA.51
UNSPSC Code:
12352200
Servizio Tecnico
Hai bisogno di aiuto? Il nostro team di scienziati qualificati è a tua disposizione.
Permettici di aiutarti


product line

MISSION®

form

solid

mature sequence

CACCGACUCUGUCUCCUGCAG

Sanger mature/minor accession no.

Sanger microRNA accession no.

storage temp.

−20°C

General description

Individual synthetic microRNA inhibitors were designed using a proprietary algorithm, which is based on the work of Haraguchi, T, et al. and in collaboration with Dr. Hideo Iba, University of Tokyo. This algorithm utilizes the tough decoy (TuD) design. miRNA are known to regulate gene expression in a variety of manners, including translational repression, mRNA cleavage and deadenylation.

The MISSION synthetic miRNA Inhibitors are small, double-stranded RNA molecules designed to inhibit a specific mature miRNA. The miRNA inhibitors were designed using the mature miRNA sequence information from miRBase and are 2′-O-methylated RNA duplexes with a miRNA binding site on each strand. Optimal miRNA inhibition is provided after transfection due to the robust secondary structure of the inhibitor.

  • Long lasting inhibition at very low dosage
  • Excellent resistance to cellular nucleases
  • Custom synthesis available for a variety of species

Two negative controls are available: Arabidopsis thaliana sequence (NCSTUD001) and Caenorhabditis elegans sequence (NCSTUD002)

Other Notes

Based on miRBase V19

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Pittogrammi

Health hazard

Parola di avvertenza

Warning

Codici di pericolo

Avvertenze di sicurezza

Hazard Classifications

STOT RE 2 Inhalation

Organi bersaglio

Respiratory Tract

Classe di stoccaggio

11 - Combustible Solids

Che succede?

WGK 3

Punto di infiammabilità (°F)

Not applicable

Punto di infiammabilità (°C)

Not applicable



Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number

Non trovi la versione di tuo interesse?

Se hai bisogno di una versione specifica, puoi cercare il certificato tramite il numero di lotto.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti