Autenticati per visualizzare i prezzi organizzativi e contrattuali.
Scegli un formato
Cambia visualizzazione
| Voi/SKU | Disponibilità | Prezzo |
|---|
Informazioni su questo articolo
NACRES:
NA.51
UNSPSC Code:
41105324
eCl@ss:
32119211
Prezzi e disponibilità al momento non sono disponibili
Servizio Tecnico
Hai bisogno di aiuto? Il nostro team di scienziati qualificati è a tua disposizione.
Permettici di aiutartiQuality Segment
product line
MISSION®
form
solid
mature sequence
UGUGACUGGUUGACCAGAGGGG
Sanger mature/minor accession no.
microRNA accession no.
MI0000160
storage temp.
−20°C
General description
Individual synthetic microRNA inhibitors were designed using a proprietary algorithm, which is based on the work of Haraguchi, T, et al. and in collaboration with Dr. Hideo Iba, University of Tokyo. This algorithm utilizes the tough decoy (TuD) design. miRNA are known to regulate gene expression in a variety of manners, including translational repression, mRNA cleavage and deadenylation.
The MISSION synthetic miRNA Inhibitors are small, double-stranded RNA molecules designed to inhibit a specific mature miRNA. The miRNA inhibitors were designed using the mature miRNA sequence information from miRBase and are 2′-O-methylated RNA duplexes with a miRNA binding site on each strand. Optimal miRNA inhibition is provided after transfection due to the robust secondary structure of the inhibitor.
Two negative controls are available: Arabidopsis thaliana sequence (NCSTUD001) and Caenorhabditis elegans sequence (NCSTUD002)
The MISSION synthetic miRNA Inhibitors are small, double-stranded RNA molecules designed to inhibit a specific mature miRNA. The miRNA inhibitors were designed using the mature miRNA sequence information from miRBase and are 2′-O-methylated RNA duplexes with a miRNA binding site on each strand. Optimal miRNA inhibition is provided after transfection due to the robust secondary structure of the inhibitor.
- Long lasting inhibition at very low dosage
- Excellent resistance to cellular nucleases
- Custom synthesis available for a variety of species
Two negative controls are available: Arabidopsis thaliana sequence (NCSTUD001) and Caenorhabditis elegans sequence (NCSTUD002)
Other Notes
Based on miRBase V19
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Parola di avvertenza
Warning
Codici di pericolo
Avvertenze di sicurezza
Hazard Classifications
STOT RE 2 Inhalation
Organi bersaglio
Respiratory Tract
Classe di stoccaggio
11 - Combustible Solids
Che succede?
WGK 3
Punto di infiammabilità (°F)
Not applicable
Punto di infiammabilità (°C)
Not applicable
Scegli una delle versioni più recenti:
Possiedi già questo prodotto?
I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.
