HMI1908
MISSION® microRNA Mimic
hsa-miR-4801
Iniciar sesión para ver los precios por organización y contrato.
Acerca de este artículo
product line
MISSION®
form
solid
mature sequence
UACACAAGAAAACCAAGGCUCA
Sanger mature/minor accession no.
Sanger microRNA accession no.
storage temp.
−20°C
Gene Information
human ... hsa-miR-4801(100616435)
General description
The ready-to-use MISSION miRNA mimics are small, double-stranded RNA molecules designed to mimic endogenous mature miRNA molecules when introduced into cells. miRNA are known to regulate gene expression in a variety of manners, including translational repression, mRNA cleavage and deadenylation. MISSION miRNA Mimics, a member of MISSION RNAi product family, provides miRNA researchers with a range of options from individual MISSION mimics to a full library of human miRNA mimics based on latest version of miRBase (currently hosted by the University of Manchester, previously hosted by the Sanger Institute).
- Optimized and ready for transfection.
- Novel MISSION miRNA mimic design has been functionally tested for knockdown efficiency against natural miRNA targets.
- Unique MISSION miRNA mimic design significantly reduces possible sense strand off target effects.
- Available as a whole human library and individual miRNA targets.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Clase de almacenamiento
13 - Non Combustible Solids
¿Qué está pasando?
WGK 3
Punto de inflamación (°F)
Not applicable
Punto de inflamación (°C)
Not applicable
Elija entre una de las versiones más recientes:
¿Ya tiene este producto?
Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.