Pular para o conteúdo
Merck

Pular para

MLMIR1237

MISSION® Lenti microRNA, Mouse

mmu-miR-5136

Faça login para ver os preços organizacionais e de contrato.

Sobre este item

NACRES:
NA.51
UNSPSC Code:
41106609
Concentration:
≥1x106 VP/ml (via p24 assay)
Mature sequence:
AUAUGCGAGGGAACUACUGG


product line

MISSION®

form

liquid

concentration

≥1x106 VP/ml (via p24 assay)

mature sequence

AUAUGCGAGGGAACUACUGG

Sanger mature/minor accession no.

Sanger microRNA accession no.

shipped in

dry ice

storage temp.

−70°C

General description

Sigma′s Mission Lenti-miRs express miRNAs from a common backbone, whose structure meets requirements for accurate Dicer processing and a partially complementary strand is designed to mimic the base pairing pattern in the backbone structure using a proprietary algorithm. Oligos containing the microRNA sequences are cloned into the TRC2-pLKO-puro vector. Each miRNA construct has been cloned and sequence verified. Mature microRNA sequences are obtained from miRBase.Lentiviral transduction particles are produced from sequence-verified lentiviral plasmid vectors. Oligos containing the microRNA sequences are cloned into the TRC2-pLKO-puro vector. Co-transfection of this vector into the appropriate cell line with compatible packaging plasmids produces viral particles that can be used to transduce mammalian cells. The polymerase II promoter, elongation factor 1 alpha (EF1A), was chosen to drive miRNA expression needed for reverse transcription of viral RNA and integration of viral DNA into the host cell genome. Additionally, the Woodchuck Hepatitis Post-Transcriptional Regulatory element allowing for enhanced expression of transgenes delivered by lentiviral vectors. This lentiviral vector also carries a puromycin resistance gene for selection of cells. Unlike murine-based MMLV or MSCV retroviral systems, lentiviral-based particles permit efficient infection and integration of the specific miRNA construct into differentiated and non-dividing cells, such as neurons and dendritic cells.

Other Notes

Based on miRBase V20 Mature ID
Two negative controls are available: NCLMIR001 and NCLMIR002

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Classe de armazenamento

12 - Non Combustible Liquids

O que está acontecendo?

WGK 3

Ponto de inflamação (°F)

Not applicable

Ponto de inflamação (°C)

Not applicable



Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documentos section.

Se precisar de ajuda, entre em contato Atendimento ao cliente

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos




Questions

Reviews

No rating value

Active Filters