Direkt zum Inhalt
Merck

EMU049871

MISSION® esiRNA

targeting mouse Sox4

Anmelden zur Ansicht der Organisations- und Vertragspreise.

Größe auswählen


Über diesen Artikel

NACRES:
NA.51
UNSPSC Code:
41105324
Technischer Dienst
Benötigen Sie Hilfe? Unser Team von erfahrenen Wissenschaftlern ist für Sie da.
Unterstützung erhalten
Technischer Dienst
Benötigen Sie Hilfe? Unser Team von erfahrenen Wissenschaftlern ist für Sie da.
Unterstützung erhalten

Produktname

MISSION® esiRNA, targeting mouse Sox4

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AAACAGAGTGAGGGGAAGAGGGCCGTCTCCCTCCCGGTTTCCAGTTCTTGCACGCTGTTTCTTAGAGAGTCTGCAGTGGGGGAACTCTGCCGGTAACCAGCTCCCCTTCTTGCAGGAGGGAGGGAGAAACATACATTTATTCATGCCGGTCTGTTGCATGCAAGCTTCTTGGCTTCCTACCTTGCAACAAAATAATTGCACCAACTCCTCAGCGCCGATTCCGCCCACAGAGAGTCCCGGAGCCAGAGTCGCTTTGGCTTTGCACTGCAGGAAAGGGACTTAGGCGCTAGAGACGATGTCGCTTTCCTGAGCTACCGCGAGCTCTCGTGAACTGCAATCGACTGCTTCAGGGAAAGGGGTGGGGGAAAGACTTGCCCCGGAGGCGGCGAGAAACTTGCGTTTGGAAGATACTCCGGCTACCAACGTTT

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklasse

12 - Non Combustible Liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Hier finden Sie alle aktuellen Versionen:

Analysenzertifikate (COA)

Lot/Batch Number

Die passende Version wird nicht angezeigt?

Wenn Sie eine bestimmte Version benötigen, können Sie anhand der Lot- oder Chargennummer nach einem spezifischen Zertifikat suchen.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Jie Xi et al.
American journal of cancer research, 7(11), 2180-2189 (2017-12-09)
Ovarian cancer (OC) is one of the most fatal gynecological cancer in women worldwide. Long noncoding RNA (lncRNA) lncBRM was found to be associated with the progression and prognosis of hepatocellular carcinoma (HCC). However, the expression level, clinical significance and
Tae Mi Yoon et al.
BMC cancer, 15, 888-888 (2015-11-12)
In humans, sex-determining region-Y (SRY) related high-mobility-group box 4 (SOX4) is linked to development and tumorigenesis. SOX4 is over-expressed in several cancers and has prognostic significance. This study evaluated whether SOX4 affects oncogenic behavior and chemoradiotherapy response in head and
Chao Chen et al.
The Journal of neuroscience : the official journal of the Society for Neuroscience, 35(29), 10629-10642 (2015-07-24)
As the cerebral cortex forms, specialized molecular cascades direct the expansion of progenitor pools, the differentiation of neurons, or the maturation of discrete neuronal subtypes, together ensuring that the correct amounts and classes of neurons are generated. In several neural

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung