Skip to Content
MilliporeSigma

EHU091861

MISSION® esiRNA

targeting human ENG

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

Product Name

MISSION® esiRNA, targeting human ENG

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CATGCAGATCTGGACCACTGGAGAATACTCCTTCAAGATCTTTCCAGAGAAAAACATTCGTGGCTTCAAGCTCCCAGACACACCTCAAGGCCTCCTGGGGGAGGCCCGGATGCTCAATGCCAGCATTGTGGCATCCTTCGTGGAGCTACCGCTGGCCAGCATTGTCTCACTTCATGCCTCCAGCTGCGGTGGTAGGCTGCAGACCTCACCCGCACCGATCCAGACCACTCCTCCCAAGGACACTTGTAGCCCGGAGCTGCTCATGTCCTTGATCCAGACAAAGTGTGCCGACGACGCCATGACCCTGGTACTAAAGAAAGAGCTTGTTGCGCATTTGAAGTGCACCATCACGGGCCTGACCTTCTGGGACCCCAGCTGTGAGGCAGAGGACAGGGGTGACAAGTTTGTCTTGCGCAGTGCTTACT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

Gene Information

human ... ENG(2022), ENG(2022)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Ryoko Sakamoto et al.
The Journal of investigative dermatology, 140(10), 2060-2072 (2020-03-07)
Angiosarcoma is a rare malignant tumor derived from endothelial cells, and its prognosis is poor because advanced angiosarcoma is often resistant to taxane therapy. Endoglin (CD105) acts as a coreceptor for TGF-β signaling and is overexpressed in tumor-associated endothelial cells
Priyanka Singh et al.
Cancer research, 78(11), 2978-2989 (2018-03-15)
Inhibin is a heterodimeric TGFβ family ligand that is expressed in many cancers and is a selective biomarker for ovarian cancers; however, its tumor-specific functions remain unknown. Here, we demonstrate that the α subunit of inhibin (INHA), which is critical
Elisa Rossi et al.
Cellular and molecular life sciences : CMLS, 73(8), 1715-1739 (2015-12-10)
The circulatory system is walled off by different cell types, including vascular mural cells and podocytes. The interaction and interplay between endothelial cells (ECs) and mural cells, such as vascular smooth muscle cells or pericytes, play a pivotal role in
Krishnendu Pal et al.
Molecular cancer therapeutics, 13(10), 2264-2275 (2014-08-16)
Endoglin, a 180-kDa disulfide-linked homodimeric transmembrane receptor protein mostly expressed in tumor-associated endothelial cells, is an endogenous binding partner of GAIP-interacting protein, C terminus (GIPC). Endoglin functions as a coreceptor of TβRII that binds TGFβ and is important for vascular
Caixia Yuan et al.
Experimental and therapeutic medicine, 17(4), 2547-2556 (2019-03-25)
Bone morphogenetic protein (BMP) expression has been observed in the uterus in previous studies. However, the influence of BMP7 on blastocyst implantation remains unclear. Blastocysts first act on luminal endometrial epithelial cells during implantation. The purpose of the present study

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service