Se connecter pour consulter les tarifs organisationnels et contractuels.
A propos de cet article
NACRES:
NA.51
UNSPSC Code:
41105324
eCl@ss:
32119211
product line
MISSION®
form
solid
mature sequence
CGGUACGAUCGCGGCGGGAUAUC
Sanger mature/minor accession no.
Sanger microRNA accession no.
storage temp.
−20°C
General description
Individual synthetic microRNA inhibitors were designed using a proprietary algorithm, which is based on the work of Haraguchi, T, et al. and in collaboration with Dr. Hideo Iba, University of Tokyo.† This algorithm utilizes the tough decoy (TuD) design. miRNA are known to regulate gene expression in a variety of manners, including translational repression, mRNA cleavage and deadenylation.
The MISSION synthetic miRNA Inhibitors are small, double-stranded RNA molecules designed to inhibit a specific mature miRNA. The miRNA inhibitors were designed using the mature miRNA sequence information from miRBase and are 2′-O-methylated RNA duplexes with a miRNA binding site on each strand. Optimal miRNA inhibition is provided after transfection due to the robust secondary structure of the inhibitor.
The MISSION synthetic miRNA Inhibitors are small, double-stranded RNA molecules designed to inhibit a specific mature miRNA. The miRNA inhibitors were designed using the mature miRNA sequence information from miRBase and are 2′-O-methylated RNA duplexes with a miRNA binding site on each strand. Optimal miRNA inhibition is provided after transfection due to the robust secondary structure of the inhibitor.
- Long lasting inhibition at very low dosage
- Excellent resistance to cellular nucleases
- Custom synthesis available for a variety of species
Other Notes
Based on miRBase V19
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Mot-clé
Warning
Codes de danger
Mentions de précaution
Hazard Classifications
STOT RE 2 Inhalation
Organes cibles
Respiratory Tract
Classe de stockage
11 - Combustible Solids
Que se passe-t-il ?
WGK 3
Point d'éclair (°F)
Not applicable
Point d'éclair (°C)
Not applicable
Faites votre choix parmi les versions les plus récentes :
Déjà en possession de ce produit ?
Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.
